EMBOSS: infoassembly

infoassembly

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Display information about assemblies

Description

infoassembly writes statistics for a sequence assembly.

The initial release is a basic version. More output can be added. Please contact the authors with suggestions.

Algorithm

None.

Usage

Here is a sample session with infoassembly

% infoassembly sam::samspec1.4example.sam stdout -auto Read distribution: ------------------ READ_CATEGORY #READS Av_Read_Length all reads 6 10.33 first of pair 1 9.00 second of pair 1 17.00 pair 2 13.00 unpaired 4 9.00 Contig stats: ------------- CONTIG LENGTH Mean_QUAL #READS Max DEPTH Mean_DEPTH %GC ref 45 0.00 6 0 0.00 0.00

Go to the input files for this example

Example 2

% infoassembly sam::xxx.sam stdout -auto -qual qualsdist.txt Phred encoding: Sanger / Illumina 1.9 Read distribution: ------------------ READ_CATEGORY #READS Av_Read_Length all reads 2 35.00 first of pair 1 35.00 second of pair 1 35.00 pair 2 35.00 unpaired 0 Contig stats: ------------- CONTIG LENGTH Mean_QUAL #READS Max DEPTH Mean_DEPTH %GC chr20 62435964 25.36 2 2 1.97 0.00

Go to the input files for this example
Go to the output files for this example

Example 3

% infoassembly sam::../data/samspec1.4example.ref.fasta Read distribution: ------------------ READ_CATEGORY #READS Av_Read_Length all reads 6 10.33 first of pair 1 9.00 second of pair 1 17.00 pair 2 13.00 unpaired 4 9.00 Contig stats: ------------- CONTIG LENGTH Mean_QUAL #READS Max DEPTH Mean_DEPTH %GC ref 45 0.00 6 3 1.82 46.67

Go to the input files for this example

Example 4

% infoassembly sam::../data/samspec1.4example.ref.fasta -gc gcbias.txt Read distribution: ------------------ READ_CATEGORY #READS Av_Read_Length all reads 6 10.33 first of pair 1 9.00 second of pair 1 17.00 pair 2 13.00 unpaired 4 9.00 Contig stats: ------------- CONTIG LENGTH Mean_QUAL #READS Max DEPTH Mean_DEPTH %GC ref 45 0.00 6 3 1.82 46.67

Go to the output files for this example

Command line arguments

Display information about assemblies
Version: EMBOSS:6.6.0.0

   Standard (Mandatory) qualifiers:
  [-assembly]          assembly   (no help text) assembly value
  [-outassembly]       outassembly (no help text) outassembly value
  [-gcbiasmetricsoutfile] outfile    [*.infoassembly] GC bias metrics
  [-qualvaluesdistoutfile] outfile    [*.infoassembly] Distribution of quality
                                  values for the reads

   Additional (Optional) qualifiers:
   -refsequence        seqset     Reference sequences in the assembly
   -windowsize         integer    [100] The size of windows on the genome that
                                  are used to bin reads. (Any integer value)
   -bisulfite          boolean    [N] If this is true, it is assumed that the
                                  reads were bisulfite treated

   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-assembly" associated qualifiers
   -cbegin1            integer    Start of the contig/consensus sequences
   -cend1              integer    End of the contig/consensus sequences
   -iformat1           string     Input assembly format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -idbname1           string     User-provided database name

   "-refsequence" associated qualifiers
   -sbegin             integer    Start of each sequence to be used
   -send               integer    End of each sequence to be used
   -sreverse           boolean    Reverse (if DNA)
   -sask               boolean    Ask for begin/end/reverse
   -snucleotide        boolean    Sequence is nucleotide
   -sprotein           boolean    Sequence is protein
   -slower             boolean    Make lower case
   -supper             boolean    Make upper case
   -scircular          boolean    Sequence is circular
   -squick             boolean    Read id and sequence only
   -sformat            string     Input sequence format
   -iquery             string     Input query fields or ID list
   -ioffset            integer    Input start position offset
   -sdbname            string     Database name
   -sid                string     Entryname
   -ufo                string     UFO features
   -fformat            string     Features format
   -fopenfile          string     Features file name

   "-outassembly" associated qualifiers
   -odirectory2        string     Output directory
   -oformat2           string     Assembly output format

   "-gcbiasmetricsoutfile" associated qualifiers
   -odirectory3        string     Output directory

   "-qualvaluesdistoutfile" associated qualifiers
   -odirectory4        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default

Standard (Mandatory) qualifiers

[-assembly]
(Parameter 1) assembly (no help text) assembly value Assembly of sequence reads

[-outassembly]
(Parameter 2) outassembly (no help text) outassembly value Assembly of sequence reads

[-gcbiasmetricsoutfile]
(Parameter 3) outfile GC bias metrics Output file <*>.infoassembly

[-qualvaluesdistoutfile]
(Parameter 4) outfile Distribution of quality values for the reads Output file <*>.infoassembly

Additional (Optional) qualifiers

-refsequence seqset Reference sequences in the assembly Readable set of sequences Required

-windowsize integer The size of windows on the genome that are used to bin reads. Any integer value 100

-bisulfite boolean If this is true, it is assumed that the reads were bisulfite treated Boolean value Yes/No No

Advanced (Unprompted) qualifiers

(none)

Associated qualifiers

"-assembly" associated assembly qualifiers

-cbegin1
-cbegin_assembly integer Start of the contig/consensus sequences Any integer value 0

-cend1
-cend_assembly integer End of the contig/consensus sequences Any integer value 0

-iformat1
-iformat_assembly string Input assembly format Any string

-iquery1
-iquery_assembly string Input query fields or ID list Any string

-ioffset1
-ioffset_assembly integer Input start position offset Any integer value 0

-idbname1
-idbname_assembly string User-provided database name Any string

"-refsequence" associated seqset qualifiers

-sbegin integer Start of each sequence to be used Any integer value 0

-send integer End of each sequence to be used Any integer value 0

-sreverse boolean Reverse (if DNA) Boolean value Yes/No N

-sask boolean Ask for begin/end/reverse Boolean value Yes/No N

-snucleotide boolean Sequence is nucleotide Boolean value Yes/No N

-sprotein boolean Sequence is protein Boolean value Yes/No N

-slower boolean Make lower case Boolean value Yes/No N

-supper boolean Make upper case Boolean value Yes/No N

-scircular boolean Sequence is circular Boolean value Yes/No N

-squick boolean Read id and sequence only Boolean value Yes/No N

-sformat string Input sequence format Any string

-iquery string Input query fields or ID list Any string

-ioffset integer Input start position offset Any integer value 0

-sdbname string Database name Any string

-sid string Entryname Any string

-ufo string UFO features Any string

-fformat string Features format Any string

-fopenfile string Features file name Any string

"-outassembly" associated outassembly qualifiers

-odirectory2
-odirectory_outassembly string Output directory Any string

-oformat2
-oformat_outassembly string Assembly output format Any string

"-gcbiasmetricsoutfile" associated outfile qualifiers

-odirectory3
-odirectory_gcbiasmetricsoutfile string Output directory Any string

"-qualvaluesdistoutfile" associated outfile qualifiers

-odirectory4
-odirectory_qualvaluesdistoutfile string Output directory Any string

General qualifiers

-auto boolean Turn off prompts Boolean value Yes/No N

-stdout boolean Write first file to standard output Boolean value Yes/No N

-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N

-options boolean Prompt for standard and additional values Boolean value Yes/No N

-debug boolean Write debug output to program.dbg Boolean value Yes/No N

-verbose boolean Report some/full command line options Boolean value Yes/No Y

-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N

-warning boolean Report warnings Boolean value Yes/No Y

-error boolean Report errors Boolean value Yes/No Y

-fatal boolean Report fatal errors Boolean value Yes/No Y

-die boolean Report dying program messages Boolean value Yes/No Y

-version boolean Report version number and exit Boolean value Yes/No N

Qualifier	Type	Description	Allowed values	Default
Standard (Mandatory) qualifiers
[-assembly] (Parameter 1)	assembly	(no help text) assembly value	Assembly of sequence reads
[-outassembly] (Parameter 2)	outassembly	(no help text) outassembly value	Assembly of sequence reads
[-gcbiasmetricsoutfile] (Parameter 3)	outfile	GC bias metrics	Output file	<>*.infoassembly
[-qualvaluesdistoutfile] (Parameter 4)	outfile	Distribution of quality values for the reads	Output file	<>*.infoassembly
Additional (Optional) qualifiers
-refsequence	seqset	Reference sequences in the assembly	Readable set of sequences	Required
-windowsize	integer	The size of windows on the genome that are used to bin reads.	Any integer value	100
-bisulfite	boolean	If this is true, it is assumed that the reads were bisulfite treated	Boolean value Yes/No	No
Advanced (Unprompted) qualifiers
(none)
Associated qualifiers
"-assembly" associated assembly qualifiers
-cbegin1 -cbegin_assembly	integer	Start of the contig/consensus sequences	Any integer value	0
-cend1 -cend_assembly	integer	End of the contig/consensus sequences	Any integer value	0
-iformat1 -iformat_assembly	string	Input assembly format	Any string
-iquery1 -iquery_assembly	string	Input query fields or ID list	Any string
-ioffset1 -ioffset_assembly	integer	Input start position offset	Any integer value	0
-idbname1 -idbname_assembly	string	User-provided database name	Any string
"-refsequence" associated seqset qualifiers
-sbegin	integer	Start of each sequence to be used	Any integer value	0
-send	integer	End of each sequence to be used	Any integer value	0
-sreverse	boolean	Reverse (if DNA)	Boolean value Yes/No	N
-sask	boolean	Ask for begin/end/reverse	Boolean value Yes/No	N
-snucleotide	boolean	Sequence is nucleotide	Boolean value Yes/No	N
-sprotein	boolean	Sequence is protein	Boolean value Yes/No	N
-slower	boolean	Make lower case	Boolean value Yes/No	N
-supper	boolean	Make upper case	Boolean value Yes/No	N
-scircular	boolean	Sequence is circular	Boolean value Yes/No	N
-squick	boolean	Read id and sequence only	Boolean value Yes/No	N
-sformat	string	Input sequence format	Any string
-iquery	string	Input query fields or ID list	Any string
-ioffset	integer	Input start position offset	Any integer value	0
-sdbname	string	Database name	Any string
-sid	string	Entryname	Any string
-ufo	string	UFO features	Any string
-fformat	string	Features format	Any string
-fopenfile	string	Features file name	Any string
"-outassembly" associated outassembly qualifiers
-odirectory2 -odirectory_outassembly	string	Output directory	Any string
-oformat2 -oformat_outassembly	string	Assembly output format	Any string
"-gcbiasmetricsoutfile" associated outfile qualifiers
-odirectory3 -odirectory_gcbiasmetricsoutfile	string	Output directory	Any string
"-qualvaluesdistoutfile" associated outfile qualifiers
-odirectory4 -odirectory_qualvaluesdistoutfile	string	Output directory	Any string
General qualifiers
-auto	boolean	Turn off prompts	Boolean value Yes/No	N
-stdout	boolean	Write first file to standard output	Boolean value Yes/No	N
-filter	boolean	Read first file from standard input, write first file to standard output	Boolean value Yes/No	N
-options	boolean	Prompt for standard and additional values	Boolean value Yes/No	N
-debug	boolean	Write debug output to program.dbg	Boolean value Yes/No	N
-verbose	boolean	Report some/full command line options	Boolean value Yes/No	Y
-help	boolean	Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose	Boolean value Yes/No	N
-warning	boolean	Report warnings	Boolean value Yes/No	Y
-error	boolean	Report errors	Boolean value Yes/No	Y
-fatal	boolean	Report fatal errors	Boolean value Yes/No	Y
-die	boolean	Report dying program messages	Boolean value Yes/No	Y
-version	boolean	Report version number and exit	Boolean value Yes/No	N

Input file format

The input is a standard EMBOSS assembly query.

The major assembly sources are files in SAM and BAM format. infoassembly reads a sequnece assembly.

Input files for usage example

File: samspec1.4example.sam

@CO	example from SAM format specification v1.4
@HD	VN:1.3	SO:coordinate
@SQ	SN:ref	LN:45
r001	163	ref	7	30	8M2I4M1D3M	=	37	39	TTAGATAAAGGATACTG	*
r002	0	ref	9	30	3S6M1P1I4M	*	0	0	AAAAGATAAGGATA	*
r003	0	ref	9	30	5H6M	*	0	0	AGCTAA	*	NM:i:1
r004	0	ref	16	30	6M14N5M	*	0	0	ATAGCTTCAGC	*
r003	16	ref	29	30	6H5M	*	0	0	TAGGC	*	NM:i:0
r001	83	ref	37	30	9M	=	7	-39	CAGCGCCAT	*

Input files for usage example 2

File: xxx.sam

@HD	VN:1.0
@SQ	SN:chr20	LN:62435964
@RG	ID:L1	PU:SC_1_10	LB:SC_1	SM:NA12891
@RG	ID:L2	PU:SC_2_12	LB:SC_2	SM:NA12891
read_28833_29006_6945	99	chr20	28833	20	10M1D25M	=	28993	195	AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG	<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<	NM:i:1	RG:Z:L1
read_28701_28881_323b	147	chr20	28834	30	35M	=	28701	-168	ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA	<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<	MF:i:18	RG:Z:L2

Input files for usage example 3

File: samspec1.4example.ref.fasta

>ref
AGCATGTTAGATAAGATAGCTGTGCTAGTAGGCAGTCAGCGCCAT

Output file format

infoassembly writes a simple text report.

Output files for usage example 2

File: qualsdist.txt

#QUALITY: Phred quality score
#BASES: Number of bases with the quality score

QUALITY	#BASES
5	1
11	2
14	1
17	2
21	1
22	2
24	1
25	2
26	5
27	53

Output files for usage example 4

File: gcbias.txt

# GC bias metrics as described in GcBiasDetailMetrics class
# in picard  project (picard.sf.net).
# The mean base quality are determined via the error rate
# of all bases of all reads that are assigned to windows of a GC.
GC	WINDOWS	READ_STARTS	MEAN_BASE_QUALITY	NORMALIZED_COVERAGE
20	5	1	8	1.13333
30	5	2	10	2.26667
40	4	0	0	0
50	11	1	0	0.515152
60	4	1	0	1.41667
70	5	0	0	0

Data files

None.

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

Program name	Description
assemblyget	Get assembly of sequence reads

Author(s)

Mahmut Uludag
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None

Wiki

Function

Description

Algorithm

Usage

Command line arguments

Input file format

Input files for usage example

File: samspec1.4example.sam

Input files for usage example 2

File: xxx.sam

Input files for usage example 3

File: samspec1.4example.ref.fasta

Output file format

Output files for usage example 2

File: qualsdist.txt

Output files for usage example 4

File: gcbias.txt

Data files

Notes

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

Author(s)

History

Target users

Comments