abiview Wiki The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki. Please help by correcting and extending the Wiki pages. Function Display the trace in an ABI sequencer file Description abiview reads in an ABI sequencer trace file and graphically displays the data. The probabilities of each of the 4 nucleotide bases along the sequencing run is plotted and the assigned nucleotide (G, A, T, C or N) from the ABI file is overlayed on the graphs. The complete sequence is written to an output file. Usage Here is a sample session with abiview % abiview -graph cps Display the trace in an ABI sequencer file ABI sequencing trace file: abiview.abi nucleotide output sequence [abiview.fasta]: Created abiview.ps Go to the input files for this example Go to the output files for this example Command line arguments Display the trace in an ABI sequencer file Version: EMBOSS:6.6.0.0 Standard (Mandatory) qualifiers: [-infile] infile ABI sequencing trace file [-outseq] seqout [.] Nucleotide sequence filename and optional format (output USA) -graph xygraph [$EMBOSS_GRAPHICS value, or x11] Graph type (ps, hpgl, hp7470, hp7580, meta, cps, x11, tek, tekt, none, data, xterm, png, gif, pdf, svg) Additional (Optional) qualifiers: -startbase integer [0] First base to report or display (Integer 0 or more) -endbase integer [0] Last sequence base to report or display. If the default is set to zero then the value of this is taken as the maximum number of bases. (Any integer value) -yticks boolean [N] Display y-axis ticks -[no]sequence boolean [Y] Display the sequence on the graph -window integer [40] Sequence display window size (Any integer value) -bases string [GATC] Base graphs to be displayed (Any string, matching regular expression /[GATC]+/) Advanced (Unprompted) qualifiers: -separate boolean [N] Separate the trace graphs for the 4 bases Associated qualifiers: "-outseq" associated qualifiers -osformat2 string Output seq format -osextension2 string File name extension -osname2 string Base file name -osdirectory2 string Output directory -osdbname2 string Database name to add -ossingle2 boolean Separate file for each entry -oufo2 string UFO features -offormat2 string Features format -ofname2 string Features file name -ofdirectory2 string Output directory "-graph" associated qualifiers -gprompt boolean Graph prompting -gdesc string Graph description -gtitle string Graph title -gsubtitle string Graph subtitle -gxtitle string Graph x axis title -gytitle string Graph y axis title -goutfile string Output file for non interactive displays -gdirectory string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit Input file format This reads in a standard ABI trace file. Input files for usage example File: abiview.abi This file contains non-printing characters and so cannot be displayed here. File: abiview.abi This file contains non-printing characters and so cannot be displayed here. Output file format It outputs a file holding a normal nucleotide sequence. Output files for usage example File: abiview.fasta >abiview GNNNNNNNNNGNGNNGGGGTTTNANNNTNNNAGAACCCCCCTTNGAAAANNNCCACCCCA NNATAGTNGTANGAATAGTNCCCAGGCCANGCCTATCTGTGATGATTACATAGGCTAACA CATGACAAACATTTAAAAACACTAAACAATTGTTATTTATTCTTTGTTCCTATAAACCAC ACCCATTAAGCCCTTACTATATATAAGAGTTTTCAAGCCAAGAACCTGCTGCTTGGGAGG CTGATGCAGGAGAATTGCCAAGTACAAACCCTGCCTGGACTGTAAAGTGAAACCAAGGCT AGTTGTCTCACAATAAAAGATGAAGGGCAAGTGGGATCAATGCATAAAGGAGCTTGTGCC CAAGCCTGTTAGCCTTAGTTCAATTCCTGAGTACCATGAAAAGGTAGAAGGAGAGAAATG ATTTGGTACAATTTTTCTCTGTGCTGTGACACAGTACCACCCTCCTACTAATAACAAATA AAATAATGTTTAAAACAAAATAAAATAAAAATGGACTGGGATGTAGCACAATGGTAGGGT ACTTGCATAGCATGTACAAGGACCTGATTTCAATCCCCTGTGATAAAAGAAAATAAGGAA GGGAGGAAGCGTTAGGAGGAAAAATGGAATACAGAAGACACAGTGCATGGGAAGGATATG TATGTTATGAACACCAGAAATTCACTTGAAAATGAGTAAAATTTTTTTATTATTATATCA TTATTATTGGGGGGGATGTGGGCGGGGCTTGCAGAGGTATCTTTTAGAGGANGATCATTT TCCGGTTGTTGAGCAGGGCTCTGTTATGTAGGATATCTCAGANTAACAGACCCCAGGT Graphics File: abiview.ps [abiview results] The horizontal scale of the output image labelled 'Residue Position' is only a very approximate indication of the spacing of residues in the image. The real residue spacing is variable, as it relies on the speed with which the oligo-nucleotides are eluted in the ABI sequencer. Do not be surprised to see the nucleotide signals spaced at a much greater distance than the horizontal scale might suggest. Data files None. Notes An ABI file (*.abi) contains sequence trace data and base calls from a run of an ABI nucleotide sequencer machine. A trace data file is what you get back from having some DNA sequenced, for example, by a 3730XL sequencer. The files are in "binary" format and so cannot be viewed directly on screen. To inspect the sequencing data you must use a trace viewer such as abiview. Another good trace viewer is FinchTV (http://www.geospiza.com/finchtv/). It is a stand-alone program and is freely available. References None. Warnings None. Diagnostic Error Messages None. Exit status It always exits with status 0. Known bugs None. See also Program name Description cirdna Draw circular map of DNA constructs coderet Extract CDS, mRNA and translations from feature tables entret Retrieve sequence entries from flatfile databases and files extractalign Extract regions from a sequence alignment iep Calculate the isoelectric point of proteins infoalign Display basic information about a multiple sequence alignment infoseq Display basic information about sequences lindna Draw linear maps of DNA constructs pepinfo Plot amino acid properties of a protein sequence in parallel pepnet Draw a helical net for a protein sequence pepwheel Draw a helical wheel diagram for a protein sequence plotorf Plot potential open reading frames in a nucleotide sequence prettyplot Draw a sequence alignment with pretty formatting prettyseq Write a nucleotide sequence and its translation to file refseqget Get reference sequence remap Display restriction enzyme binding sites in a nucleotide sequence seqxref Retrieve all database cross-references for a sequence entry seqxrefget Retrieve all cross-referenced data for a sequence entry showalign Display a multiple sequence alignment in pretty format showfeat Display features of a sequence in pretty format showpep Display protein sequences with features in pretty format sixpack Display a DNA sequence with 6-frame translation and ORFs variationget Get sequence variations whichdb Search all sequence databases for an entry and retrieve it Author(s) Tim Carver formerly at: MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK Please report all bugs to the EMBOSS bug team (emboss-bug (c) emboss.open-bio.org) not to the original author. History Written (January 2001) - Tim Carver Target users This program is intended to be used by everyone and everything, from naive users to embedded scripts. Comments None