degapseq Wiki The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki. Please help by correcting and extending the Wiki pages. Function Remove non-alphabetic (e.g. gap) characters from sequences Description degapseq reads one or more sequences and writes them out again but stripped of any non-alphabetic characters. It's main purpose is to remove gap characters from aligned sequences, but it will also remove such things as the symbol for translation STOP ('*') in a protein sequence. Usage Here is a sample session with degapseq % degapseq dnagap.fasta nogaps.seq Remove non-alphabetic (e.g. gap) characters from sequences Go to the input files for this example Go to the output files for this example Command line arguments Remove non-alphabetic (e.g. gap) characters from sequences Version: EMBOSS:6.6.0.0 Standard (Mandatory) qualifiers: [-sequence] seqall (Gapped) sequence(s) filename and optional format, or reference (input USA) [-outseq] seqoutall [.] Sequence set(s) filename and optional format (output USA) Additional (Optional) qualifiers: (none) Advanced (Unprompted) qualifiers: (none) Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of each sequence to be used -send1 integer End of each sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -scircular1 boolean Sequence is circular -squick1 boolean Read id and sequence only -sformat1 string Input sequence format -iquery1 string Input query fields or ID list -ioffset1 integer Input start position offset -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outseq" associated qualifiers -osformat2 string Output seq format -osextension2 string File name extension -osname2 string Base file name -osdirectory2 string Output directory -osdbname2 string Database name to add -ossingle2 boolean Separate file for each entry -oufo2 string UFO features -offormat2 string Features format -ofname2 string Features file name -ofdirectory2 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit Input file format degapseq reads one or more nucleotide or protein sequences. The input is a standard EMBOSS sequence query (also known as a 'USA'). Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application. The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug. See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats. Input files for usage example File: dnagap.fasta >FASTA F10002 FASTA FORMAT DNA SEQUENCE ACGT....ACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGT Output file format The output is a sequence with no gaps. Output files for usage example File: nogaps.seq >FASTA F10002 FASTA FORMAT DNA SEQUENCE ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGT Data files None. Notes There are many different formats for storing molecular sequences in files. Some formats are specifically for aligned sequences, where gaps are inserted into the sequences for purposes of alignment. Gaps are indicated with different characters depending on the format in question, but commonly include '.', '-' and '~'. Some formats use more than one type of character to indicate different types of gaps, for example gaps at the sequence ends, internal gaps, gaps inserted by a program and gaps inserted manually by a person editing the alignment may all be denoted with different characters. EMBOSS uses the dash character ('-') only to indicate gaps. When an EMBOSS program reads a sequence with gaps, all gap characters are changed internally to a dash ('-'). Thus any distinguishing characters for different gap types are convered to a '-' on output. References None. Warnings It will remove '*' characters from protein sequences as well as removing the gap characters. Diagnostic Error Messages None. Exit status It always exits with status 0. Known bugs None. See also Program name Description aligncopy Read and write alignments aligncopypair Read and write pairs from alignments biosed Replace or delete sequence sections codcopy Copy and reformat a codon usage table cutseq Remove a section from a sequence descseq Alter the name or description of a sequence entret Retrieve sequence entries from flatfile databases and files extractalign Extract regions from a sequence alignment extractfeat Extract features from sequence(s) extractseq Extract regions from a sequence featcopy Read and write a feature table featmerge Merge two overlapping feature tables featreport Read and write a feature table feattext Return a feature table original text listor Write a list file of the logical OR of two sets of sequences makenucseq Create random nucleotide sequences makeprotseq Create random protein sequences maskambignuc Mask all ambiguity characters in nucleotide sequences with N maskambigprot Mask all ambiguity characters in protein sequences with X maskfeat Write a sequence with masked features maskseq Write a sequence with masked regions newseq Create a sequence file from a typed-in sequence nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file noreturn Remove carriage return from ASCII files nospace Remove whitespace from an ASCII text file notab Replace tabs with spaces in an ASCII text file notseq Write to file a subset of an input stream of sequences nthseq Write to file a single sequence from an input stream of sequences nthseqset Read and write (return) one set of sequences from many pasteseq Insert one sequence into another revseq Reverse and complement a nucleotide sequence seqcount Read and count sequences seqret Read and write (return) sequences seqretsetall Read and write (return) many sets of sequences seqretsplit Read sequences and write them to individual files sizeseq Sort sequences by size skipredundant Remove redundant sequences from an input set skipseq Read and write (return) sequences, skipping first few splitsource Split sequence(s) into original source sequences splitter Split sequence(s) into smaller sequences trimest Remove poly-A tails from nucleotide sequences trimseq Remove unwanted characters from start and end of sequence(s) trimspace Remove extra whitespace from an ASCII text file union Concatenate multiple sequences into a single sequence vectorstrip Remove vectors from the ends of nucleotide sequence(s) yank Add a sequence reference (a full USA) to a list file Author(s) Gary Williams formerly at: MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK Please report all bugs to the EMBOSS bug team (emboss-bug (c) emboss.open-bio.org) not to the original author. History Written (6 March 2001) - Gary Williams Target users This program is intended to be used by everyone and everything, from naive users to embedded scripts. Comments None