listor Wiki The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki. Please help by correcting and extending the Wiki pages. Function Write a list file of the logical OR of two sets of sequences Description listor reads in two sets of sequences (typically specified as list files) and writes out a list file that result from the logical union of the two sets. A list file is a file with a list of Uniform Sequence Addresses (USAs), for example, a list of file names. When comparing sequences from the input sets, no use is made of the ID name or accession number; only the sequence itself is compared. The comparison of the sequences is case-independent. The logical union is an OR operation by default. Other available operations are: AND, XOR and NOT. Algorithm All the input sequences are kept in memory while the logical unions of the two input sets of sequences is calculated. listor is therefore restricted by the available memory. Usage Here is a sample session with listor Write the logical OR of two lists: % listor ../data/file2 Write a list file of the logical OR of two sets of sequences List of USAs output file [file1.list]: Go to the input files for this example Go to the output files for this example Example 2 Write the logical AND of two lists: % listor ../data/file2 -operator and Write a list file of the logical OR of two sets of sequences List of USAs output file [file1.list]: Go to the output files for this example Example 3 Write the logical XOR of two lists: % listor ../data/file2 -operator xor Write a list file of the logical OR of two sets of sequences List of USAs output file [file1.list]: Go to the output files for this example Example 4 Write the logical NOT of two lists: % listor ../data/file2 -operator not Write a list file of the logical OR of two sets of sequences List of USAs output file [file1.list]: Go to the output files for this example Command line arguments Write a list file of the logical OR of two sets of sequences Version: EMBOSS:6.6.0.0 Standard (Mandatory) qualifiers: [-firstsequences] seqset Sequence set filename and optional format, or reference (input USA) [-secondsequences] seqset Sequence set filename and optional format, or reference (input USA) [-outfile] outfile [*.listor] The list of sequence names will be written to this list file Additional (Optional) qualifiers: -operator menu [OR] The following logical operators combine the sequences in the following ways: OR - gives all that occur in one set or the other AND - gives only those which occur in both sets XOR - gives those which only occur in one set or the other, but not in both NOT - gives those which occur in the first set except for those that also occur in the second (Values: OR (OR - merger of both sets); AND (AND - only those in both sets); XOR (XOR - only those not in both sets); NOT (NOT - those of the first set that are not in the second)) Advanced (Unprompted) qualifiers: (none) Associated qualifiers: "-firstsequences" associated qualifiers -sbegin1 integer Start of each sequence to be used -send1 integer End of each sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -scircular1 boolean Sequence is circular -squick1 boolean Read id and sequence only -sformat1 string Input sequence format -iquery1 string Input query fields or ID list -ioffset1 integer Input start position offset -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-secondsequences" associated qualifiers -sbegin2 integer Start of each sequence to be used -send2 integer End of each sequence to be used -sreverse2 boolean Reverse (if DNA) -sask2 boolean Ask for begin/end/reverse -snucleotide2 boolean Sequence is nucleotide -sprotein2 boolean Sequence is protein -slower2 boolean Make lower case -supper2 boolean Make upper case -scircular2 boolean Sequence is circular -squick2 boolean Read id and sequence only -sformat2 string Input sequence format -iquery2 string Input query fields or ID list -ioffset2 integer Input start position offset -sdbname2 string Database name -sid2 string Entryname -ufo2 string UFO features -fformat2 string Features format -fopenfile2 string Features file name "-outfile" associated qualifiers -odirectory3 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit Input file format The input sets of sequences can be of any valid USAs. The program was written to perform logical operations on list files, but in practice, wildcarded database entries and file names are also perfectly legal specifications of the input sequences. Input files for usage example File: file1 >one tagctagcg >two tagctagcggctacgt >three tagctattttatgctacgtcagtgac File: file2 >two tagctagcggctacgt >three tagctattttatgctacgtcagtgac >four gcgcggcgcgcgtgcgtcgttgctggggccc Output file format The output is simply a list of the USAs (format and sequence specification) resulting from the required logical union of the two sets of input sequence. The order that the USAs are written out is not necessarily the same as the order of either of the input sets of sequences. The results of the four types of logical union follows. Note that the duplicated sequences in these two files have been given the same name. This is not necessary for the operation of listor as it compares the sequences themselves, not the ID names of the sequences. Output files for usage example File: file1.list fasta::../../data/file1:one fasta::../../data/file1:two fasta::../../data/file1:three fasta::../../data/file2:four Output files for usage example 2 File: file1.list fasta::../../data/file1:two fasta::../../data/file1:three Output files for usage example 3 File: file1.list fasta::../../data/file1:one fasta::../../data/file2:four Output files for usage example 4 File: file1.list fasta::../../data/file1:one Data files None. Notes The inputs can be any valid USA but typically reference a list file. Some other reference such as a wildcarded database entries or file name are equally valid. The (default) logical OR of the two sets of sequences is simply the result of merging the two sets of sequences. A sequences appearing in both input sets is referenced once only in the output file. A logical AND simply lists those sequences that occur in both sets of sequences. A logical XOR lists those sequences that ONLY occur in the first set or only occur in the second set - sequences occuring in both sets are omitted (the opposite of an AND). A logical NOT lists all those sequences in the first set except for those that also occur in the second set. References None. Warnings listor is restricted by the available memory. Doing logical unions involving all of the sequences in large databases, such as EMBL, is probably impractical unless you are lucky enough to have extraordinary amounts of memory on your machine. Diagnostic Error Messages None. Exit status It always exits with status 0. Known bugs None. See also Program name Description aligncopy Read and write alignments aligncopypair Read and write pairs from alignments biosed Replace or delete sequence sections codcopy Copy and reformat a codon usage table cutseq Remove a section from a sequence degapseq Remove non-alphabetic (e.g. gap) characters from sequences descseq Alter the name or description of a sequence entret Retrieve sequence entries from flatfile databases and files extractalign Extract regions from a sequence alignment extractfeat Extract features from sequence(s) extractseq Extract regions from a sequence featcopy Read and write a feature table featmerge Merge two overlapping feature tables featreport Read and write a feature table feattext Return a feature table original text makenucseq Create random nucleotide sequences makeprotseq Create random protein sequences maskambignuc Mask all ambiguity characters in nucleotide sequences with N maskambigprot Mask all ambiguity characters in protein sequences with X maskfeat Write a sequence with masked features maskseq Write a sequence with masked regions newseq Create a sequence file from a typed-in sequence nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file noreturn Remove carriage return from ASCII files nospace Remove whitespace from an ASCII text file notab Replace tabs with spaces in an ASCII text file notseq Write to file a subset of an input stream of sequences nthseq Write to file a single sequence from an input stream of sequences nthseqset Read and write (return) one set of sequences from many pasteseq Insert one sequence into another revseq Reverse and complement a nucleotide sequence seqcount Read and count sequences seqret Read and write (return) sequences seqretsetall Read and write (return) many sets of sequences seqretsplit Read sequences and write them to individual files sizeseq Sort sequences by size skipredundant Remove redundant sequences from an input set skipseq Read and write (return) sequences, skipping first few splitsource Split sequence(s) into original source sequences splitter Split sequence(s) into smaller sequences trimest Remove poly-A tails from nucleotide sequences trimseq Remove unwanted characters from start and end of sequence(s) trimspace Remove extra whitespace from an ASCII text file union Concatenate multiple sequences into a single sequence vectorstrip Remove vectors from the ends of nucleotide sequence(s) yank Add a sequence reference (a full USA) to a list file Author(s) Gary Williams formerly at: MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK Please report all bugs to the EMBOSS bug team (emboss-bug (c) emboss.open-bio.org) not to the original author. History Written (1 Aug 2001) - Gary Williams Target users This program is intended to be used by everyone and everything, from naive users to embedded scripts. Comments None