maskfeat Wiki The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki. Please help by correcting and extending the Wiki pages. Function Write a sequence with masked features Description maskfeat reads a sequence with associated features and writes the same information to file but with features of the specified type omitted (masked). Sequence regions corresponding to the masked-out features are masked such that characters in those region are (optionally) converted to lower case and / or (optionally) replaced with the specified mask character. Usage Here is a sample session with maskfeat Mask out a feature whose type is "repeat_region" from position 2331 to 2356: % maskfeat tembl:ab000360 Write a sequence with masked features output sequence [ab000360.fasta]: Go to the input files for this example Go to the output files for this example Example 2 Change to lower-case a feature whose type is "repeat_region" from position 2331 to 2356. Note that '-supper' is used to make the whole sequence upper-case before the lower-case masking: % maskfeat tembl:ab000360 -tolower -supper Write a sequence with masked features output sequence [ab000360.fasta]: Go to the output files for this example Command line arguments Write a sequence with masked features Version: EMBOSS:6.6.0.0 Standard (Mandatory) qualifiers: [-sequence] seqall Sequence(s) filename and optional format, or reference (input USA) [-outseq] seqout [.] Sequence filename and optional format (output USA) Additional (Optional) qualifiers (* if not always prompted): -type string [repeat*] By default any feature in the feature table with a type starting 'repeat' is masked. You can set this to be any feature type you wish to mask. See http://www.ebi.ac.uk/embl/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www.expasy.org/sprot/userman.html for a list of the Swissprot feature types. The type may be wildcarded by using '*'. If you wish to mask more than one type, separate their names with spaces or commas, eg: *UTR repeat* (Any string) -tolower toggle [N] The region can be 'masked' by converting the sequence characters to lower-case, some non-EMBOSS programs e.g. fasta can interpret this as a masked region. The sequence is unchanged apart from the case change. You might like to ensure that the whole sequence is in upper-case before masking the specified regions to lower-case by using the '-supper' flag. * -maskchar string ['X' for protein, 'N' for nucleic] Character to use when masking. Default is 'X' for protein sequences, 'N' for nucleic sequences. If the mask character is set to be the SPACE character or a null character, then the sequence is 'masked' by changing it to lower-case, just as with the '-lowercase' flag. (Any string up to 1 characters) Advanced (Unprompted) qualifiers: (none) Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of each sequence to be used -send1 integer End of each sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -scircular1 boolean Sequence is circular -squick1 boolean Read id and sequence only -sformat1 string Input sequence format -iquery1 string Input query fields or ID list -ioffset1 integer Input start position offset -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outseq" associated qualifiers -osformat2 string Output seq format -osextension2 string File name extension -osname2 string Base file name -osdirectory2 string Output directory -osdbname2 string Database name to add -ossingle2 boolean Separate file for each entry -oufo2 string UFO features -offormat2 string Features format -ofname2 string Features file name -ofdirectory2 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit Input file format maskfeat reads one or more nucleotide or protein sequences with features. The input is a standard EMBOSS sequence query (also known as a 'USA') with associated feature information. Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application. The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: text, html, xml (uniprotxml), obo, embl (swissprot) Where the sequence format has no feature information, a second file can be read to load the feature data. The file is specified with the qualifier -ufo xxx and the feature format is specified with the qualifier -fformat xxx See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats. See: http://emboss.sf.net/docs/themes/FeatureFormats.html for further information on feature formats. Input files for usage example 'tembl:ab000360' is a sequence entry in the example nucleic acid database 'tembl' Database entry: tembl:ab000360 ID AB000360; SV 1; linear; genomic DNA; STD; HUM; 2582 BP. XX AC AB000360; XX DT 27-OCT-1997 (Rel. 53, Created) DT 28-SEP-2008 (Rel. 97, Last updated, Version 5) XX DE Homo sapiens PIGC gene, complete cds. XX KW . XX OS Homo sapiens (human) OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; OC Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; OC Homo. XX RN [1] RP 1-2582 RA Hong Y., Ohishi K., Inoue N., Endo Y., Fujita T., Takeda J., Kinoshita T.; RT ; RL Submitted (08-JAN-1997) to the INSDC. RL Contact:Yeongjin Hong Research Institute for Microbial Diseases, RL Immunoregulation; 3-1 Yamada-oka, Suita, Osaka 565, Japan XX RN [2] RX DOI; 10.1006/geno.1997.4893. RX PUBMED; 9325057. RA Hong Y., Ohishi K., Inoue N., Endo Y., Fujita T., Takeda J., Kinoshita T.; RT "Structures and chromosomal localizations of the RT glycosylphosphatidylinositol synthesis gene PIGC and its pseudogene RT PIGCP1"; RL Genomics 44(3):347-349(1997). XX DR Ensembl-Gn; ENSG00000135845; Homo_sapiens. DR Ensembl-Tr; ENST00000258324; Homo_sapiens. DR Ensembl-Tr; ENST00000344529; Homo_sapiens. DR Ensembl-Tr; ENST00000367728; Homo_sapiens. XX FH Key Location/Qualifiers FH FT source 1..2582 FT /organism="Homo sapiens" FT /chromosome="1" FT /map="1q23-q25" FT /mol_type="genomic DNA" FT /db_xref="taxon:9606" FT exon 808..2266 FT CDS 1101..1994 FT /codon_start=1 FT /transl_table=1 [Part of this file has been deleted for brevity] FT variation 2259 FT /replace="t" FT repeat_region 2331..2356 FT /rpt_unit_seq="gt" XX SQ Sequence 2582 BP; 694 A; 494 C; 581 G; 813 T; 0 other; ggatccctgc tgcagagggg gtaacggtgt ctggcttgcc aagcaatatt tgttgtggtc 60 tatcatggaa gaaataaagt cgggcaatat gaattttttt tttctcaaat ttgccggatg 120 gctgtggtgt ttctgactct tagttttctc attgtgaaaa aggaatgatt atcttcttcg 180 atcctctcaa gagtttcctt gttttgagta gattgatagc tctttaaagg atgctaagct 240 cagctaatgg aagaagagtc tagtttcttt gaggctttga ttttggttaa actatagagc 300 tcataccttt ctgtatggtg cagcttacta ttgtctttgg attggtaact taaaaaatac 360 aaataacatg cctttgagaa ccaataaaaa ctatggatat tatccctata aatttacaca 420 aatccagata taagcatgca atgtgatata cctaagggat atgtgaacca ctgagttaag 480 aactgcttta gagggagata caatgtgaga cacaggcttt gggataagac tttggtttga 540 atcctggctc tgctctgtta ccttagggca aagttactta agcatcttga atctcagctt 600 ttttaccaaa gcaggactaa tactaactta caaggtggtg aggattaagt gaaagaagat 660 acataaggca cttagcacat agtaggtact caataagcga tagctaacag atgtctatta 720 ttattcaagg aattataatt ttcaaatctg aaatgcagtt ttaatgtccc ataaggtgac 780 taccacatac atttttctca gacttttagt aaactgagtt gatttgactt tatctcagta 840 ctactcttga cctttcacaa ctttcgtagg ttcacagtct ctctttttct aggaacttgg 900 ctgtgttgtc ctgcctcaga gacaaattca tctattgtag gcctagcccc tgcctttgaa 960 aacaaggaaa ggttggtaga acatcaacac agcatggaat ttccagggag gtctcatttc 1020 aaaacttcat aaagaacaag aaccacctgg acttctgtga gggcgatgat taaactggcc 1080 tgagtttgaa tgaaaggata atgtatgctc aacctgtgac taacaccaag gaggtcaagt 1140 ggcagaaggt cttgtatgag cgacagccct ttcctgataa ctatgtggac cggcgattcc 1200 tggaagagct ccggaaaaac atccatgctc ggaaatacca atattgggct gtggtatttg 1260 agtccagtgt ggtgatccag cagctgtgca gtgtttgtgt ttttgtggtt atctggtggt 1320 atatggatga gggtcttctg gccccccatt ggcttttagg gactggcctg gcttcttcac 1380 tgattgggta tgttttgttt gatctcattg atggaggtga agggcggaag aagagtgggc 1440 agacccggtg ggctgacctg aagagtgccc tagtcttcat tactttcact tatgggtttt 1500 caccagtgct gaagaccctt acagagtctg tcagcactga caccatctat gccatgtcag 1560 tcttcatgct gttaggccat ctcatctttt ttgactatgg tgccaatgct gccattgtat 1620 ccagcacact atccttgaac atggccatct ttgcttctgt atgcttggca tcacgtcttc 1680 cccggtccct gcatgccttc atcatggtga catttgccat tcagattttt gccctgtggc 1740 ccatgttgca gaagaaacta aaggcatgta ctccccggag ctatgtgggg gtcacactgc 1800 tttttgcatt ttcagccgtg ggaggcctac tgtccattag tgctgtggga gccgtactct 1860 ttgcccttct gctgatgtct atctcatgtc tgtgttcatt ctacctcatt cgcttgcagc 1920 tttttaaaga aaacattcat gggccttggg atgaagctga aatcaaggaa gacttgtcca 1980 ggttcctcag ttaaattagg acatccatta cattattaaa gcaagctgat agattagcct 2040 cctaactagt atagaactta aagacagagt tccattctgg aagcagcatg tcattgtggt 2100 aagagaatag agatcaaaac caaaaaaaat gaaccaaagg cttgggtggt gagggtgctt 2160 atcctttctg ttattttgta gatgaaaaaa ctttctgggg acctcttgaa ttacatgctg 2220 taacatatga agtgatgtgg tttctattaa aaaaataaca catccatcaa gttgtctcat 2280 gatttttcca taaacaggag gcagacagag gggcatgaag agtgaagtaa gtgtgtgtgt 2340 gtgtgtgtgt gtgtgtaaag tcacttcttt ctaccctttt caatgtgcta atgctctttt 2400 atttatctag ggctcaaatc ttagaacaca gggtgctatg ctcagttttg ttgcccaaga 2460 tcacagaatt ggttacttaa ccttgactca gagtttctac cttgttctta gggaagcata 2520 tcacaactaa ttgcaaagca gagtgtgatg tgtcacaata agcagaatgc tagggggaat 2580 tc 2582 // Output file format The output is a standard EMBOSS sequence file. The results can be output in one of several styles by using the command-line qualifier -osformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq. See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats. The sequence file has features masked with the specified character. Output files for usage example File: ab000360.fasta >AB000360 AB000360.1 Homo sapiens PIGC gene, complete cds. ggatccctgctgcagagggggtaacggtgtctggcttgccaagcaatatttgttgtggtc tatcatggaagaaataaagtcgggcaatatgaattttttttttctcaaatttgccggatg gctgtggtgtttctgactcttagttttctcattgtgaaaaaggaatgattatcttcttcg atcctctcaagagtttccttgttttgagtagattgatagctctttaaaggatgctaagct cagctaatggaagaagagtctagtttctttgaggctttgattttggttaaactatagagc tcatacctttctgtatggtgcagcttactattgtctttggattggtaacttaaaaaatac aaataacatgcctttgagaaccaataaaaactatggatattatccctataaatttacaca aatccagatataagcatgcaatgtgatatacctaagggatatgtgaaccactgagttaag aactgctttagagggagatacaatgtgagacacaggctttgggataagactttggtttga atcctggctctgctctgttaccttagggcaaagttacttaagcatcttgaatctcagctt ttttaccaaagcaggactaatactaacttacaaggtggtgaggattaagtgaaagaagat acataaggcacttagcacatagtaggtactcaataagcgatagctaacagatgtctatta ttattcaaggaattataattttcaaatctgaaatgcagttttaatgtcccataaggtgac taccacatacatttttctcagacttttagtaaactgagttgatttgactttatctcagta ctactcttgacctttcacaactttcgtaggttcacagtctctctttttctaggaacttgg ctgtgttgtcctgcctcagagacaaattcatctattgtaggcctagcccctgcctttgaa aacaaggaaaggttggtagaacatcaacacagcatggaatttccagggaggtctcatttc aaaacttcataaagaacaagaaccacctggacttctgtgagggcgatgattaaactggcc tgagtttgaatgaaaggataatgtatgctcaacctgtgactaacaccaaggaggtcaagt ggcagaaggtcttgtatgagcgacagccctttcctgataactatgtggaccggcgattcc tggaagagctccggaaaaacatccatgctcggaaataccaatattgggctgtggtatttg agtccagtgtggtgatccagcagctgtgcagtgtttgtgtttttgtggttatctggtggt atatggatgagggtcttctggccccccattggcttttagggactggcctggcttcttcac tgattgggtatgttttgtttgatctcattgatggaggtgaagggcggaagaagagtgggc agacccggtgggctgacctgaagagtgccctagtcttcattactttcacttatgggtttt caccagtgctgaagacccttacagagtctgtcagcactgacaccatctatgccatgtcag tcttcatgctgttaggccatctcatcttttttgactatggtgccaatgctgccattgtat ccagcacactatccttgaacatggccatctttgcttctgtatgcttggcatcacgtcttc cccggtccctgcatgccttcatcatggtgacatttgccattcagatttttgccctgtggc ccatgttgcagaagaaactaaaggcatgtactccccggagctatgtgggggtcacactgc tttttgcattttcagccgtgggaggcctactgtccattagtgctgtgggagccgtactct ttgcccttctgctgatgtctatctcatgtctgtgttcattctacctcattcgcttgcagc tttttaaagaaaacattcatgggccttgggatgaagctgaaatcaaggaagacttgtcca ggttcctcagttaaattaggacatccattacattattaaagcaagctgatagattagcct cctaactagtatagaacttaaagacagagttccattctggaagcagcatgtcattgtggt aagagaatagagatcaaaaccaaaaaaaatgaaccaaaggcttgggtggtgagggtgctt atcctttctgttattttgtagatgaaaaaactttctggggacctcttgaattacatgctg taacatatgaagtgatgtggtttctattaaaaaaataacacatccatcaagttgtctcat gatttttccataaacaggaggcagacagaggggcatgaagagtgaagtaaNNNNNNNNNN NNNNNNNNNNNNNNNNaaagtcacttctttctacccttttcaatgtgctaatgctctttt atttatctagggctcaaatcttagaacacagggtgctatgctcagttttgttgcccaaga tcacagaattggttacttaaccttgactcagagtttctaccttgttcttagggaagcata tcacaactaattgcaaagcagagtgtgatgtgtcacaataagcagaatgctagggggaat tc Output files for usage example 2 File: ab000360.fasta >AB000360 AB000360.1 Homo sapiens PIGC gene, complete cds. GGATCCCTGCTGCAGAGGGGGTAACGGTGTCTGGCTTGCCAAGCAATATTTGTTGTGGTC TATCATGGAAGAAATAAAGTCGGGCAATATGAATTTTTTTTTTCTCAAATTTGCCGGATG GCTGTGGTGTTTCTGACTCTTAGTTTTCTCATTGTGAAAAAGGAATGATTATCTTCTTCG ATCCTCTCAAGAGTTTCCTTGTTTTGAGTAGATTGATAGCTCTTTAAAGGATGCTAAGCT CAGCTAATGGAAGAAGAGTCTAGTTTCTTTGAGGCTTTGATTTTGGTTAAACTATAGAGC TCATACCTTTCTGTATGGTGCAGCTTACTATTGTCTTTGGATTGGTAACTTAAAAAATAC AAATAACATGCCTTTGAGAACCAATAAAAACTATGGATATTATCCCTATAAATTTACACA AATCCAGATATAAGCATGCAATGTGATATACCTAAGGGATATGTGAACCACTGAGTTAAG AACTGCTTTAGAGGGAGATACAATGTGAGACACAGGCTTTGGGATAAGACTTTGGTTTGA ATCCTGGCTCTGCTCTGTTACCTTAGGGCAAAGTTACTTAAGCATCTTGAATCTCAGCTT TTTTACCAAAGCAGGACTAATACTAACTTACAAGGTGGTGAGGATTAAGTGAAAGAAGAT ACATAAGGCACTTAGCACATAGTAGGTACTCAATAAGCGATAGCTAACAGATGTCTATTA TTATTCAAGGAATTATAATTTTCAAATCTGAAATGCAGTTTTAATGTCCCATAAGGTGAC TACCACATACATTTTTCTCAGACTTTTAGTAAACTGAGTTGATTTGACTTTATCTCAGTA CTACTCTTGACCTTTCACAACTTTCGTAGGTTCACAGTCTCTCTTTTTCTAGGAACTTGG CTGTGTTGTCCTGCCTCAGAGACAAATTCATCTATTGTAGGCCTAGCCCCTGCCTTTGAA AACAAGGAAAGGTTGGTAGAACATCAACACAGCATGGAATTTCCAGGGAGGTCTCATTTC AAAACTTCATAAAGAACAAGAACCACCTGGACTTCTGTGAGGGCGATGATTAAACTGGCC TGAGTTTGAATGAAAGGATAATGTATGCTCAACCTGTGACTAACACCAAGGAGGTCAAGT GGCAGAAGGTCTTGTATGAGCGACAGCCCTTTCCTGATAACTATGTGGACCGGCGATTCC TGGAAGAGCTCCGGAAAAACATCCATGCTCGGAAATACCAATATTGGGCTGTGGTATTTG AGTCCAGTGTGGTGATCCAGCAGCTGTGCAGTGTTTGTGTTTTTGTGGTTATCTGGTGGT ATATGGATGAGGGTCTTCTGGCCCCCCATTGGCTTTTAGGGACTGGCCTGGCTTCTTCAC TGATTGGGTATGTTTTGTTTGATCTCATTGATGGAGGTGAAGGGCGGAAGAAGAGTGGGC AGACCCGGTGGGCTGACCTGAAGAGTGCCCTAGTCTTCATTACTTTCACTTATGGGTTTT CACCAGTGCTGAAGACCCTTACAGAGTCTGTCAGCACTGACACCATCTATGCCATGTCAG TCTTCATGCTGTTAGGCCATCTCATCTTTTTTGACTATGGTGCCAATGCTGCCATTGTAT CCAGCACACTATCCTTGAACATGGCCATCTTTGCTTCTGTATGCTTGGCATCACGTCTTC CCCGGTCCCTGCATGCCTTCATCATGGTGACATTTGCCATTCAGATTTTTGCCCTGTGGC CCATGTTGCAGAAGAAACTAAAGGCATGTACTCCCCGGAGCTATGTGGGGGTCACACTGC TTTTTGCATTTTCAGCCGTGGGAGGCCTACTGTCCATTAGTGCTGTGGGAGCCGTACTCT TTGCCCTTCTGCTGATGTCTATCTCATGTCTGTGTTCATTCTACCTCATTCGCTTGCAGC TTTTTAAAGAAAACATTCATGGGCCTTGGGATGAAGCTGAAATCAAGGAAGACTTGTCCA GGTTCCTCAGTTAAATTAGGACATCCATTACATTATTAAAGCAAGCTGATAGATTAGCCT CCTAACTAGTATAGAACTTAAAGACAGAGTTCCATTCTGGAAGCAGCATGTCATTGTGGT AAGAGAATAGAGATCAAAACCAAAAAAAATGAACCAAAGGCTTGGGTGGTGAGGGTGCTT ATCCTTTCTGTTATTTTGTAGATGAAAAAACTTTCTGGGGACCTCTTGAATTACATGCTG TAACATATGAAGTGATGTGGTTTCTATTAAAAAAATAACACATCCATCAAGTTGTCTCAT GATTTTTCCATAAACAGGAGGCAGACAGAGGGGCATGAAGAGTGAAGTAAgtgtgtgtgt gtgtgtgtgtgtgtgtAAAGTCACTTCTTTCTACCCTTTTCAATGTGCTAATGCTCTTTT ATTTATCTAGGGCTCAAATCTTAGAACACAGGGTGCTATGCTCAGTTTTGTTGCCCAAGA TCACAGAATTGGTTACTTAACCTTGACTCAGAGTTTCTACCTTGTTCTTAGGGAAGCATA TCACAACTAATTGCAAAGCAGAGTGTGATGTGTCACAATAAGCAGAATGCTAGGGGGAAT TC Data files None. Notes Formats such as EMBL or SWISSPROT include features in the sequence annotation. Otherwise, features they may be supplied in a separate file and specified with the qualifier -ufo or -fopenfile / -fformat. The feature type to mask is by default repeat*, i.e. any type whose name starts with repeat will be omitted from the output file. Any other type of feature(s) may be specified with the -type qualifier. To specify more than one type of feature, separate their names with spaces or commas. The names may be wild-carded with asterisks * to find gruops of feature types sharing a common part of their names. If you are unsure of the names of feature types in use, please consult http://www.ebi.ac.uk/Services/WebFeat/ (EMBL feature types) and see Appendix A of the Swissprot user manual in http://www.uniprot.org/manual/sequence_annotation (Swissprot feature types). References None. Warnings None. Diagnostic Error Messages None. Exit status It always exits with a status of 0. Known bugs None. See also Program name Description aligncopy Read and write alignments aligncopypair Read and write pairs from alignments biosed Replace or delete sequence sections codcopy Copy and reformat a codon usage table cutseq Remove a section from a sequence degapseq Remove non-alphabetic (e.g. gap) characters from sequences descseq Alter the name or description of a sequence entret Retrieve sequence entries from flatfile databases and files extractalign Extract regions from a sequence alignment extractfeat Extract features from sequence(s) extractseq Extract regions from a sequence featcopy Read and write a feature table featmerge Merge two overlapping feature tables featreport Read and write a feature table feattext Return a feature table original text listor Write a list file of the logical OR of two sets of sequences makenucseq Create random nucleotide sequences makeprotseq Create random protein sequences maskambignuc Mask all ambiguity characters in nucleotide sequences with N maskambigprot Mask all ambiguity characters in protein sequences with X maskseq Write a sequence with masked regions newseq Create a sequence file from a typed-in sequence nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file noreturn Remove carriage return from ASCII files nospace Remove whitespace from an ASCII text file notab Replace tabs with spaces in an ASCII text file notseq Write to file a subset of an input stream of sequences nthseq Write to file a single sequence from an input stream of sequences nthseqset Read and write (return) one set of sequences from many pasteseq Insert one sequence into another revseq Reverse and complement a nucleotide sequence seqcount Read and count sequences seqret Read and write (return) sequences seqretsetall Read and write (return) many sets of sequences seqretsplit Read sequences and write them to individual files showfeat Display features of a sequence in pretty format sizeseq Sort sequences by size skipredundant Remove redundant sequences from an input set skipseq Read and write (return) sequences, skipping first few splitsource Split sequence(s) into original source sequences splitter Split sequence(s) into smaller sequences trimest Remove poly-A tails from nucleotide sequences trimseq Remove unwanted characters from start and end of sequence(s) trimspace Remove extra whitespace from an ASCII text file twofeat Find neighbouring pairs of features in sequence(s) union Concatenate multiple sequences into a single sequence vectorstrip Remove vectors from the ends of nucleotide sequence(s) yank Add a sequence reference (a full USA) to a list file Author(s) Gary Williams formerly at: MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK Please report all bugs to the EMBOSS bug team (emboss-bug (c) emboss.open-bio.org) not to the original author. History Written (2000) - Gary Williams Target users This program is intended to be used by everyone and everything, from naive users to embedded scripts. Comments None