vectorstrip Wiki The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki. Please help by correcting and extending the Wiki pages. Function Remove vectors from the ends of nucleotide sequence(s) Description vectorstrip reads one or more nucleotide sequences and writes them out again but with any of a specified set of vector sequences removed from the 5' and 3' termini. An output file with a summary of the results is also written. The vector sequences to strip out are (typically) provided in an input file. The pair of 5' and 3' vector sequences are searched against each input sequence allowing a specified maximum level of mismatches. Each 5' hit is paired with each 3' hit and the resulting subsequences output. By default only the best match between the vector patterns and each sequence are reported. Optionally, all matches up to the specified maximum mismatch level are reported. Usage Here is a sample session with vectorstrip % vectorstrip @vecseqs.list Remove vectors from the ends of nucleotide sequence(s) Are your vector sequences in a file? [Y]: Cloning vector definition file (optional): vectors Max allowed % mismatch [10]: Show only the best hits (minimise mismatches)? [Y]: Output file [pbluescript.vectorstrip]: vector.strip output sequence(s) [pbluescript.fasta]: vector.fasta Go to the input files for this example Go to the output files for this example Command line arguments Remove vectors from the ends of nucleotide sequence(s) Version: EMBOSS:6.6.0.0 Standard (Mandatory) qualifiers (* if not always prompted): [-sequence] seqall Nucleotide sequence(s) filename and optional format, or reference (input USA) [-[no]readfile] toggle [Y] Are your vector sequences in a file? * -vectorsfile infile Cloning vector definition file (optional) -mismatch integer [10] Max allowed % mismatch (Any integer value) -[no]besthits boolean [Y] Show only the best hits (minimise mismatches)? * -alinker string The 5' sequence (Any string) * -blinker string The 3' sequence (Any string) [-outfile] outfile [*.vectorstrip] Output file name [-outseq] seqoutall [.] Sequence set(s) filename and optional format (output USA) Additional (Optional) qualifiers: -allsequences boolean [N] Show all sequences in output Advanced (Unprompted) qualifiers: (none) Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of each sequence to be used -send1 integer End of each sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -scircular1 boolean Sequence is circular -squick1 boolean Read id and sequence only -sformat1 string Input sequence format -iquery1 string Input query fields or ID list -ioffset1 integer Input start position offset -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outfile" associated qualifiers -odirectory3 string Output directory "-outseq" associated qualifiers -osformat4 string Output seq format -osextension4 string File name extension -osname4 string Base file name -osdirectory4 string Output directory -osdbname4 string Database name to add -ossingle4 boolean Separate file for each entry -oufo4 string UFO features -offormat4 string Features format -ofname4 string Features file name -ofdirectory4 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit Input file format Input files for usage example File: vecseqs.list ../../data/bluescript.seq ../../data/litmus.seq ../../data/pTYB1.seq File: vectors # Example vector file for use by vectorstrip # Vector 5' 3' pTYB1 GACGGCGGCCGCGAATTCC TCGAGGGCTCTTCCTGC pBS_KS+ GGGTACCGGGCCCCCCC TCGAGGTCGACGGTA pLITMUS GATATCCTGCAGGAATTCC TCGAGACCGTACGTGCG The same fragment has been cloned into the XhoI site of the polylinker of each vector. The cloned fragment is represented in lower case and the vector sequence in upper case so the sequence trimming can be readily seen. Each line of the vector file should contain the name of the vector, the 5' pattern and the 3' pattern. Lines beginning with # are treated as comments and ignored. If only one vector sequence is given in the it will be assumed that this is the 5' pattern. If a vector name is given but no pattern data, the vector will not be used. Output file format Output files for usage example File: vector.strip Sequence: pBlueScript Vector: pTYB1 No match Sequence: pBlueScript Vector: pBS_KS+ 5' sequence matches: From 67 to 83 with 0 mismatches 3' sequence matches: From 205 to 219 with 0 mismatches Sequences output to file: from 84 to 204 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca cacagtgacatgagagacacagatatagagacagatagacgatagacaga cagcatatatagacagatagc sequence trimmed from 5' end: GGAAACAGCTAATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACT AAAGGGAACAAAAGCTGGGTACCGGGCCCCCCC sequence trimmed from 3' end: TCGAGGTCGACGGTATCGATAAGCTTGATATCG Sequence: pBlueScript Vector: pLITMUS No match Sequence: litmus.seq Vector: pTYB1 No match Sequence: litmus.seq Vector: pBS_KS+ No match Sequence: litmus.seq Vector: pLITMUS 5' sequence matches: From 43 to 61 with 0 mismatches 3' sequence matches: From 183 to 199 with 0 mismatches Sequences output to file: from 62 to 182 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca cacagtgacatgagagacacagatatagagacagatagacgatagacaga cagcatatatagacagatagc sequence trimmed from 5' end: TCTAGAACCGGTGACGTCTCCCATGGTGAAGCTTGGATCCACGATATCCT GCAGGAATTCC sequence trimmed from 3' end: TCGAGACCGTACGTGCGCGCGAATGCATCCAGATCTTCCCTCTAGTCAAG GCCTTAAGTGAGTCGTATTACGGA Sequence: pTYB1.seq Vector: pTYB1 5' sequence matches: From 40 to 58 with 0 mismatches 3' sequence matches: From 180 to 196 with 0 mismatches Sequences output to file: from 59 to 179 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca cacagtgacatgagagacacagatatagagacagatagacgatagacaga cagcatatatagacagatagc sequence trimmed from 5' end: CTTTAAGAAGGAGATATACATATGGCTAGCTCGCGAGTCGACGGCGGCCG CGAATTCC sequence trimmed from 3' end: TCGAGGGCTCTTCCTGCTTTGCCAAGGGTACCAATGTTTTAATGGCGGAT Sequence: pTYB1.seq Vector: pBS_KS+ No match Sequence: pTYB1.seq Vector: pLITMUS No match File: vector.fasta >pBlueScript_from_84_to_204 KS+ tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag c >litmus.seq_from_62_to_182 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag c >pTYB1.seq_from_59_to_179 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag c Two types of output file are produced: 1. The sequence file(s) - contain the trimmed subsequence(s) produced by vectorstrip either all in one file, or in separate files if the command line flag -ossingle is used. 2. Results summary file Data files None. Notes vectorstrip is intended for stripping vector sequence from the ends of sequences of interest. For example, if a fragment has been cloned into a vector and then sequenced, the sequence may contain vector data eg from the cloning polylinker at the 5' and 3' ends of the sequence. vectorstrip will remove these contaminating regions and output trimmed sequence ready for input into another application. vectorstrip is suitable for use with low quality sequence data as it can allow for mismatches between the sequence and the vector patterns provided. You can specify the maximum level of mismatch expected. Vector data can either be provided in a file or interactively. If presented in a file, vectorstrip will search all input sequences with all vectors listed in that file. The intention is that the user can maintain a single file for use with vectorstrip, containing all the linker sequences commonly used in the laboratory. The two patterns for each vector are searched separately against the sequence. Once the search is completed, each of the hits of the 5' sequence is paired with each of the hits of the 3' sequence and the resulting subsequences are output. For example, if the 5' sequence matches the sequence from (a) position 30-60, and(b)position 70-100, and the 3' sequence matches from 150-175, then two subsequences will be output: from 61-149, and from 101-149. The lower the quality of the sequence, the more likely multiple hits become if nonzero mismatches are accepted. Default behaviour is to report only the best matches between the vector patterns and the sequence. This means that if you specify a maximum mismatch level of 10%, but the vector patterns match the sequence with zero mismatches, the search will stop and the program will output only these "best" matches. If there are no perfect matches, the program will try searching again allowing 1 mismatch, then 2, and so on until either the patterns match the sequence or the maximum specified mismatch level is exceeded. You can tell vectorstrip to show all possible matches up to your specified maximum level, as illustrated in the examples below. References None. Warnings None. Diagnostic Error Messages 1. No suitable vectors found - exiting indicates that the 5' and 3' patterns for the vectors were blank - usually this is as a result of an empty vectorfile. 2. Illegal pattern indicates that one of the vector patterns could not be compiled and therefore cannot be searched. 3. 5' and 3' sequence matches are identical; inconclusive indicates that the 5' and 3' patterns provided were identical, and that they only match the sequence once. Thus the program cannot determine which part of the sequence is vector and which is insert. Exit status It always exits with status 0. Known bugs None. See also Program name Description aligncopy Read and write alignments aligncopypair Read and write pairs from alignments biosed Replace or delete sequence sections codcopy Copy and reformat a codon usage table cutseq Remove a section from a sequence degapseq Remove non-alphabetic (e.g. gap) characters from sequences descseq Alter the name or description of a sequence entret Retrieve sequence entries from flatfile databases and files extractalign Extract regions from a sequence alignment extractfeat Extract features from sequence(s) extractseq Extract regions from a sequence featcopy Read and write a feature table featmerge Merge two overlapping feature tables featreport Read and write a feature table feattext Return a feature table original text listor Write a list file of the logical OR of two sets of sequences makenucseq Create random nucleotide sequences makeprotseq Create random protein sequences maskambignuc Mask all ambiguity characters in nucleotide sequences with N maskambigprot Mask all ambiguity characters in protein sequences with X maskfeat Write a sequence with masked features maskseq Write a sequence with masked regions newseq Create a sequence file from a typed-in sequence nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file noreturn Remove carriage return from ASCII files nospace Remove whitespace from an ASCII text file notab Replace tabs with spaces in an ASCII text file notseq Write to file a subset of an input stream of sequences nthseq Write to file a single sequence from an input stream of sequences nthseqset Read and write (return) one set of sequences from many pasteseq Insert one sequence into another revseq Reverse and complement a nucleotide sequence seqcount Read and count sequences seqret Read and write (return) sequences seqretsetall Read and write (return) many sets of sequences seqretsplit Read sequences and write them to individual files sizeseq Sort sequences by size skipredundant Remove redundant sequences from an input set skipseq Read and write (return) sequences, skipping first few splitsource Split sequence(s) into original source sequences splitter Split sequence(s) into smaller sequences trimest Remove poly-A tails from nucleotide sequences trimseq Remove unwanted characters from start and end of sequence(s) trimspace Remove extra whitespace from an ASCII text file union Concatenate multiple sequences into a single sequence yank Add a sequence reference (a full USA) to a list file Author(s) Val Curwen formerly at: Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK. Please report all bugs to the EMBOSS bug team (emboss-bug (c) emboss.open-bio.org) not to the original author. History 16 August 2000 - Val Curwen - Written. Target users This program is intended to be used by everyone and everything, from naive users to embedded scripts. Comments None