extractalign
Wiki
The master copies of EMBOSS documentation are available at
http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.
Please help by correcting and extending the Wiki pages.
Function
Extract regions from a sequence alignment
Description
extractalign allows you to specify one or more regions of a sequence
alignment to extract sub-sequences from to build up a resulting
sub-sequence alignment. extractalign reads in a sequence alignment and
a set of regions of that alignment as specified by pairs of start and
end positions (either on the command-line or contained in a file) using
gapped alignment positions as the coordinates, and writes out the
specified regions of the input sequence in the order in which they have
been specified. Thus, if the sequence "AAAGGGTTT" has been input and
the regions: "7-9, 3-4" have been specified, then the output sequence
will be: "TTTAG".
Usage
Here is a sample session with extractalign
Extract the region from position 10 to 20:
% extractalign dna.msf result.seq -regions "11-30"
Extract regions from a sequence alignment
Go to the input files for this example
Go to the output files for this example
Command line arguments
Extract regions from a sequence alignment
Version: EMBOSS:6.6.0.0
Standard (Mandatory) qualifiers:
[-sequence] seqset (Aligned) sequence set filename and optional
format, or reference (input USA)
-regions range [Whole sequence] Regions to extract.
A set of regions is specified by a set of
pairs of positions.
The positions are integers.
They are separated by any non-digit,
non-alpha character.
Examples of region specifications are:
24-45, 56-78
1:45, 67=99;765..888
1,5,8,10,23,45,57,99
[-outseq] seqoutall [.] Sequence set(s)
filename and optional format (output USA)
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-scircular1 boolean Sequence is circular
-squick1 boolean Read id and sequence only
-sformat1 string Input sequence format
-iquery1 string Input query fields or ID list
-ioffset1 integer Input start position offset
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outseq" associated qualifiers
-osformat2 string Output seq format
-osextension2 string File name extension
-osname2 string Base file name
-osdirectory2 string Output directory
-osdbname2 string Database name to add
-ossingle2 boolean Separate file for each entry
-oufo2 string UFO features
-offormat2 string Features format
-ofname2 string Features file name
-ofdirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
Input file format
extractalign reads aligned nucleotide or protein sequences.
The input is a standard EMBOSS sequence query (also known as a 'USA').
Major sequence database sources defined as standard in EMBOSS
installations include srs:embl, srs:uniprot and ensembl
Data can also be read from sequence output in any supported format
written by an EMBOSS or third-party application.
The input format can be specified by using the command-line qualifier
-sformat xxx, where 'xxx' is replaced by the name of the required
format. The available format names are: gff (gff3), gff2, embl (em),
genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw),
dasgff and debug.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further
information on sequence formats.
Input files for usage example
File: dna.msf
!!NA_MULTIPLE_ALIGNMENT
dna.msf MSF: 120 Type: N January 01, 1776 12:00 Check: 3196 ..
Name: MSFM1 Len: 120 Check: 8587 Weight: 1.00
Name: MSFM2 Len: 120 Check: 6178 Weight: 1.00
Name: MSFM3 Len: 120 Check: 8431 Weight: 1.00
//
MSFM1 ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC
MSFM2 ACGTACGTAC GTACGTACGT ....ACGTAC GTACGTACGT ACGTACGTAC
MSFM3 ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT CGTACGTACG
MSFM1 GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT
MSFM2 GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT
MSFM3 TACGTACGTA CGTACGTACG TACGTACGTA ACGTACGTAC GTACGTACGT
MSFM1 ACGTACGTAC GTACGTACGT
MSFM2 ACGTACGTTG CAACGTACGT
MSFM3 ACGTACGTAC GTACGTACGT
You can specify a file of ranges to extract by giving the '-regions'
qualifier the value '@' followed by the name of the file containing the
ranges. (eg: '-regions @myfile').
The format of the range file is:
* Comment lines start with '#' in the first column.
* Comment lines and blank lines are ignored.
* The line may start with white-space.
* There are two positive (integer) numbers per line separated by one
or more space or TAB characters.
* The second number must be greater or equal to the first number.
* There can be optional text after the two numbers to annotate the
line.
* White-space before or after the text is removed.
An example range file is:
# this is my set of ranges
12 23
4 5 this is like 12-23, but smaller
67 10348 interesting region
Output file format
The output is a normal sequence file.
Output files for usage example
File: result.seq
>MSFM1
GTACGTACGTACGTACGTAC
>MSFM2
GTACGTACGT----ACGTAC
>MSFM3
GTACGTACGTACGTACGTAC
If the option '-separate' is used then each specified region is written
to the output file as a separate sequence. The name of the sequence is
created from the name of the original sequence with the start and end
positions of the range appended with underscore characters between
them,
For example: "XYZ region 2 to 34" is written as: "XYZ_2_34"
Data files
None.
Notes
None.
References
None.
Warnings
None.
Diagnostic Error Messages
Several warning messages about malformed region specifications:
* Non-digit found in region ...
* Unpaired start of a region found in ...
* Non-digit found in region ...
* The start of a pair of region positions must be smaller than the
end in ...
Exit status
It exits with status 0, unless a region is badly constructed.
Known bugs
None noted.
Comments
See also
Program name Description
abiview Display the trace in an ABI sequencer file
aligncopy Read and write alignments
aligncopypair Read and write pairs from alignments
biosed Replace or delete sequence sections
codcopy Copy and reformat a codon usage table
coderet Extract CDS, mRNA and translations from feature tables
cutseq Remove a section from a sequence
degapseq Remove non-alphabetic (e.g. gap) characters from sequences
descseq Alter the name or description of a sequence
entret Retrieve sequence entries from flatfile databases and files
extractfeat Extract features from sequence(s)
extractseq Extract regions from a sequence
featcopy Read and write a feature table
featmerge Merge two overlapping feature tables
featreport Read and write a feature table
feattext Return a feature table original text
infoalign Display basic information about a multiple sequence alignment
infoseq Display basic information about sequences
listor Write a list file of the logical OR of two sets of sequences
makenucseq Create random nucleotide sequences
makeprotseq Create random protein sequences
maskambignuc Mask all ambiguity characters in nucleotide sequences with
N
maskambigprot Mask all ambiguity characters in protein sequences with X
maskfeat Write a sequence with masked features
maskseq Write a sequence with masked regions
newseq Create a sequence file from a typed-in sequence
nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file
noreturn Remove carriage return from ASCII files
nospace Remove whitespace from an ASCII text file
notab Replace tabs with spaces in an ASCII text file
notseq Write to file a subset of an input stream of sequences
nthseq Write to file a single sequence from an input stream of
sequences
nthseqset Read and write (return) one set of sequences from many
pasteseq Insert one sequence into another
refseqget Get reference sequence
revseq Reverse and complement a nucleotide sequence
seqcount Read and count sequences
seqret Read and write (return) sequences
seqretsetall Read and write (return) many sets of sequences
seqretsplit Read sequences and write them to individual files
seqxref Retrieve all database cross-references for a sequence entry
seqxrefget Retrieve all cross-referenced data for a sequence entry
showalign Display a multiple sequence alignment in pretty format
sizeseq Sort sequences by size
skipredundant Remove redundant sequences from an input set
skipseq Read and write (return) sequences, skipping first few
splitsource Split sequence(s) into original source sequences
splitter Split sequence(s) into smaller sequences
trimest Remove poly-A tails from nucleotide sequences
trimseq Remove unwanted characters from start and end of sequence(s)
trimspace Remove extra whitespace from an ASCII text file
union Concatenate multiple sequences into a single sequence
variationget Get sequence variations
vectorstrip Remove vectors from the ends of nucleotide sequence(s)
whichdb Search all sequence databases for an entry and retrieve it
yank Add a sequence reference (a full USA) to a list file
Author(s)
Peter Rice
European Bioinformatics Institute, Wellcome Trust Genome Campus,
Hinxton, Cambridge CB10 1SD, UK
Please report all bugs to the EMBOSS bug team
(emboss-bug (c) emboss.open-bio.org) not to the original author.
History
Target users
This program is intended to be used by everyone and everything, from
naive users to embedded scripts.
Comments
None