needleall
Wiki
The master copies of EMBOSS documentation are available at
http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.
Please help by correcting and extending the Wiki pages.
Function
Many-to-many pairwise alignments of two sequence sets
Description
needleall reads a set of input sequences and compares them all to one
or more sequences, writing their optimal global sequence alignments to
file. It uses the Needleman-Wunsch alignment algorithm to find the
optimum alignment (including gaps) of two sequences along their entire
length. The algorithm uses a dynamic programming method to ensure the
alignment is optimum, by exploring all possible alignments and choosing
the best. A scoring matrix is read that contains values for every
possible residue or nucleotide match. Needleall finds the alignment
with the maximum possible score where the score of an alignment is
equal to the sum of the matches taken from the scoring matrix, minus
penalties arising from opening and extending gaps in the aligned
sequences. The substitution matrix and gap opening and extension
penalties are user-specified.
Algorithm
The Needleman-Wunsch algorithm is a member of the class of algorithms
that can calculate the best score and alignment of two sequences in the
order of mn steps, where n and m are the sequence lengths. These
dynamic programming algorithms were first developed for protein
sequence comparison by Needleman and Wunsch, though similar methods
were independently devised during the late 1960's and early 1970's for
use in the fields of speech processing and computer science.
An important problem is the treatment of gaps, i.e., spaces inserted to
optimise the alignment score. A penalty is subtracted from the score
for each gap opened (the 'gap open' penalty) and a penalty is
subtracted from the score for the total number of gap spaces multiplied
by a cost (the 'gap extension' penalty). Typically, the cost of
extending a gap is set to be 5-10 times lower than the cost for opening
a gap.
Penalty for a gap of n positions is calculated using the following
formula:
gap opening penalty + (n - 1) * gap extension penalty
In a Needleman-Wunsch global alignment, the entire length of each
sequence is aligned. The sequences might be partially overlapping or
one sequence might be aligned entirely internally to the other. There
is no penalty for the hanging ends of the overlap. In bioinformatics,
it is usually reasonable to assume that the sequences are incomplete
and there should be no penalty for failing to align the missing bases.
Usage
Here is a sample session with needleall
% needleall -minscore 40 -stdout -auto ../data/test1_illumina.fastq
Illumina_DpnII_Gex_PCR_Primer_2 FC12044_91407_8_200_406_24 45 (41.0)
Illumina_NlaIII_Gex_PCR_Primer_2 FC12044_91407_8_200_406_24 45 (41.0)
Illumina_Small_RNA_PCR_Primer_2 FC12044_91407_8_200_406_24 45 (41.0)
Illumina_DpnII_Gex_Adapters1_1 FC12044_91407_8_200_106_131 35 (40.5)
Illumina_Paired_End_DNA_Adapters1_1 FC12044_91407_8_200_57_85 35 (41.0)
Illumina_DpnII_Gex_Adapters1_1 FC12044_91407_8_200_154_436 31 (42.0)
Illumina_Genomic_DNA_PCR_Primers1_1 FC12044_91407_8_200_83_511 64 (42.0)
Illumina_Paired_End_DNA_PCR_Primers1_1 FC12044_91407_8_200_83_511 64 (42.0)
Illumina_DpnII_Gex_Adapters1_2 FC12044_91407_8_200_303_427 33 (40.5)
Illumina_DpnII_Gex_PCR_Primer_2 FC12044_91407_8_200_303_427 51 (40.5)
Illumina_DpnII_Gex_sequencing_primer FC12044_91407_8_200_303_427 38 (44.5)
Illumina_NlaIII_Gex_Adapters1_2 FC12044_91407_8_200_303_427 36 (40.5)
Illumina_NlaIII_Gex_PCR_Primer_2 FC12044_91407_8_200_303_427 51 (40.5)
Illumina_NlaIII_Gex_sequencing_primer FC12044_91407_8_200_303_427 39 (40.5)
Illumina_Small_RNA_5p_Adapter FC12044_91407_8_200_303_427 33 (40.5)
Illumina_Small_RNA_PCR_Primer_2 FC12044_91407_8_200_303_427 51 (40.5)
Illumina_Small_RNA_sequencing_primer FC12044_91407_8_200_303_427 38 (44.5)
Illumina_Paired_End_DNA_Adapters1_1 FC12044_91407_8_200_553_135 33 (44.5)
Illumina_DpnII_Gex_PCR_Primer_2 FC12044_91407_8_200_139_74 51 (46.0)
Illumina_DpnII_Gex_sequencing_primer FC12044_91407_8_200_139_74 38 (42.0)
Illumina_NlaIII_Gex_PCR_Primer_2 FC12044_91407_8_200_139_74 51 (46.0)
Illumina_Small_RNA_PCR_Primer_2 FC12044_91407_8_200_139_74 51 (46.0)
Illumina_Small_RNA_sequencing_primer FC12044_91407_8_200_139_74 38 (42.0)
#---------------------------------------
#---------------------------------------
Go to the input files for this example
Go to the output files for this example
Command line arguments
Many-to-many pairwise alignments of two sequence sets
Version: EMBOSS:6.6.0.0
Standard (Mandatory) qualifiers:
[-asequence] seqset Sequence set filename and optional format,
or reference (input USA)
[-bsequence] seqall Sequence(s) filename and optional format, or
reference (input USA)
-gapopen float [10.0 for any sequence] The gap open penalty
is the score taken away when a gap is
created. The best value depends on the
choice of comparison matrix. The default
value assumes you are using the EBLOSUM62
matrix for protein sequences, and the
EDNAFULL matrix for nucleotide sequences.
(Floating point number from 1.0 to 100.0)
-gapextend float [0.5 for any sequence] The gap extension,
penalty is added to the standard gap penalty
for each base or residue in the gap. This
is how long gaps are penalized. Usually you
will expect a few long gaps rather than many
short gaps, so the gap extension penalty
should be lower than the gap penalty. An
exception is where one or both sequences are
single reads with possible sequencing
errors in which case you would expect many
single base gaps. You can get this result by
setting the gap open penalty to zero (or
very low) and using the gap extension
penalty to control gap scoring. (Floating
point number from 0.0 to 10.0)
[-outfile] align [*.needleall] Output alignment file name
(default -aformat score)
Additional (Optional) qualifiers:
-datafile matrixf [EBLOSUM62 for protein, EDNAFULL for DNA]
This is the scoring matrix file used when
comparing sequences. By default it is the
file 'EBLOSUM62' (for proteins) or the file
'EDNAFULL' (for nucleic sequences). These
files are found in the 'data' directory of
the EMBOSS installation.
-endweight boolean [N] Apply end gap penalties.
-endopen float [10.0 for any sequence] The end gap open
penalty is the score taken away when an end
gap is created. The best value depends on
the choice of comparison matrix. The default
value assumes you are using the EBLOSUM62
matrix for protein sequences, and the
EDNAFULL matrix for nucleotide sequences.
(Floating point number from 1.0 to 100.0)
-endextend float [0.5 for any sequence] The end gap
extension, penalty is added to the end gap
penalty for each base or residue in the end
gap. (Floating point number from 0.0 to
10.0)
-minscore float [1.0 for any sequence] Minimum alignment
score to report an alignment. (Floating
point number from -10.0 to 100.0)
-errfile outfile [needleall.error] Error file to be written
to
Advanced (Unprompted) qualifiers:
-[no]brief boolean [Y] Brief identity and similarity
Associated qualifiers:
"-asequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-scircular1 boolean Sequence is circular
-squick1 boolean Read id and sequence only
-sformat1 string Input sequence format
-iquery1 string Input query fields or ID list
-ioffset1 integer Input start position offset
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-bsequence" associated qualifiers
-sbegin2 integer Start of each sequence to be used
-send2 integer End of each sequence to be used
-sreverse2 boolean Reverse (if DNA)
-sask2 boolean Ask for begin/end/reverse
-snucleotide2 boolean Sequence is nucleotide
-sprotein2 boolean Sequence is protein
-slower2 boolean Make lower case
-supper2 boolean Make upper case
-scircular2 boolean Sequence is circular
-squick2 boolean Read id and sequence only
-sformat2 string Input sequence format
-iquery2 string Input query fields or ID list
-ioffset2 integer Input start position offset
-sdbname2 string Database name
-sid2 string Entryname
-ufo2 string UFO features
-fformat2 string Features format
-fopenfile2 string Features file name
"-outfile" associated qualifiers
-aformat3 string Alignment format
-aextension3 string File name extension
-adirectory3 string Output directory
-aname3 string Base file name
-awidth3 integer Alignment width
-aaccshow3 boolean Show accession number in the header
-adesshow3 boolean Show description in the header
-ausashow3 boolean Show the full USA in the alignment
-aglobal3 boolean Show the full sequence in alignment
"-errfile" associated qualifiers
-odirectory string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
Input file format
needleall reads in two nucleotide or protein sequences inputs. Both can
be one or more sequences. All sequences in the first ionput are aligned
to all sequences in the second input.
The input is a standard EMBOSS sequence query (also known as a 'USA').
Major sequence database sources defined as standard in EMBOSS
installations include srs:embl, srs:uniprot and ensembl
Data can also be read from sequence output in any supported format
written by an EMBOSS or third-party application.
The input format can be specified by using the command-line qualifier
-sformat xxx, where 'xxx' is replaced by the name of the required
format. The available format names are: gff (gff3), gff2, embl (em),
genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw),
dasgff and debug.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further
information on sequence formats.
Input files for usage example
File: illumina_adapter_primer.fa
>Illumina_Genomici_DNA_Adapters1_1
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
>Illumina_Genomic_DNA_Adapters1_2
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Illumina_Genomic_DNA_PCR_Primers1_1
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Illumina_Genomic_DNA_PCR_Primers1_2
CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
>Illumina_Genomic_DNA_sequencing_primer
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Illumina_Paired_End_DNA_Adapters1_1
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
>Illumina_Paired_End_DNA_Adapters1_2
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Illumina_Paired_End_DNA_PCR_Primers1_1
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Illumina_Paired_End_DNA_PCR_Primers1_2
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
>Illumina_Paired_End_DNA_sequencing_primer_1
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Illumina_Paired_End_DNA_sequencing_primer_2
CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
>Illumina_DpnII_Gex_Adapters1_1
GATCGTCGGACTGTAGAACTCTGAAC
>Illumina_DpnII_Gex_Adapters1_2
ACAGGTTCAGAGTTCTACAGTCCGAC
>Illumina_DpnII_Gex_Adapters2_1
CAAGCAGAAGACGGCATACGA
>Illumina_DpnII_Gex_Adapters2_2
TCGTATGCCGTCTTCTGCTTG
>Illumina_DpnII_Gex_PCR_Primer_1
CAAGCAGAAGACGGCATACGA
>Illumina_DpnII_Gex_PCR_Primer_2
AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
>Illumina_DpnII_Gex_sequencing_primer
CGACAGGTTCAGAGTTCTACAGTCCGACGATC
>Illumina_NlaIII_Gex_Adapters1_1
TCGGACTGTAGAACTCTGAAC
>Illumina_NlaIII_Gex_Adapters1_2
ACAGGTTCAGAGTTCTACAGTCCGACATG
>Illumina_NlaIII_Gex_Adapters2_1
CAAGCAGAAGACGGCATACGANN
>Illumina_NlaIII_Gex_Adapters2_2
TCGTATGCCGTCTTCTGCTTG
>Illumina_NlaIII_Gex_PCR_Primer_1
CAAGCAGAAGACGGCATACGA
>Illumina_NlaIII_Gex_PCR_Primer_2
AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
>Illumina_NlaIII_Gex_sequencing_primer
CCGACAGGTTCAGAGTTCTACAGTCCGACATG
>Illumina_Small_RNA_RT_Primer
CAAGCAGAAGACGGCATACGA
>Illumina_Small_RNA_5p_Adapter
GTTCAGAGTTCTACAGTCCGACGATC
>Illumina_Small_RNA_3p_Adapter
TCGTATGCCGTCTTCTGCTTGT
>Illumina_Small_RNA_PCR_Primer_1
CAAGCAGAAGACGGCATACGA
>Illumina_Small_RNA_PCR_Primer_2
AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
>Illumina_Small_RNA_sequencing_primer
CGACAGGTTCAGAGTTCTACAGTCCGACGATC
File: test1_illumina.fastq
@FC12044_91407_8_200_406_24
GTTAGCTCCCACCTTAAGATGTTTA
+FC12044_91407_8_200_406_24
SXXTXXXXXXXXXTTSUXSSXKTMQ
@FC12044_91407_8_200_720_610
CTCTGTGGCACCCCATCCCTCACTT
+FC12044_91407_8_200_720_610
OXXXXXXXXXXXXXXXXXTSXQTXU
@FC12044_91407_8_200_345_133
GATTTTTTAACAATAAACGTACATA
+FC12044_91407_8_200_345_133
OQTOOSFORTFFFIIOFFFFFFFFF
@FC12044_91407_8_200_106_131
GTTGCCCAGGCTCGTCTTGAACTCC
+FC12044_91407_8_200_106_131
XXXXXXXXXXXXXXSXXXXISTXQS
@FC12044_91407_8_200_916_471
TGATTGAAGGTAGGGTAGCATACTG
+FC12044_91407_8_200_916_471
XXXXXXXXXXXXXXXUXXUSXXTXW
@FC12044_91407_8_200_57_85
GCTCCAATAGCGCAGAGGAAACCTG
+FC12044_91407_8_200_57_85
XFXMXSXXSXXXOSQROOSROFQIQ
@FC12044_91407_8_200_10_437
GCTGCTTGGGAGGCTGAGGCAGGAG
+FC12044_91407_8_200_10_437
USXSXXXXXXUXXXSXQXXUQXXKS
@FC12044_91407_8_200_154_436
AGACCTTTGGATACAATGAACGACT
+FC12044_91407_8_200_154_436
MKKMQTSRXMSQTOMRFOOIFFFFF
@FC12044_91407_8_200_336_64
AGGGAATTTTAGAGGAGGGCTGCCG
+FC12044_91407_8_200_336_64
STQMOSXSXSQXQXXKXXXKFXFFK
@FC12044_91407_8_200_620_233
TCTCCATGTTGGTCAGGCTGGTCTC
+FC12044_91407_8_200_620_233
XXXXXXXXXXXXXXXXXXXXXSXSW
@FC12044_91407_8_200_902_349
TGAACGTCGAGACGCAAGGCCCGCC
+FC12044_91407_8_200_902_349
XMXSSXMXXSXQSXTSQXFKSKTOF
@FC12044_91407_8_200_40_618
CTGTCCCCACGGCGGGGGGGCCTGG
+FC12044_91407_8_200_40_618
TXXXXSXXXXXXXXXXXXXRKFOXS
@FC12044_91407_8_200_83_511
GATGTACTCTTACACCCAGACTTTG
+FC12044_91407_8_200_83_511
SOXXXXXUXXXXXXQKQKKROOQSU
@FC12044_91407_8_200_76_246
TCAAGGGTGGATCTTGGCTCCCAGT
+FC12044_91407_8_200_76_246
XTXTUXXXXXRXXXTXXSUXSRFXQ
@FC12044_91407_8_200_303_427
TTGCGACAGAGTTTTGCTCTTGTCC
+FC12044_91407_8_200_303_427
XXQROXXXXIXFQXXXOIQSSXUFF
@FC12044_91407_8_200_31_299
TCTGCTCCAGCTCCAAGACGCCGCC
+FC12044_91407_8_200_31_299
XRXTSXXXRXXSXQQOXQTSQSXKQ
@FC12044_91407_8_200_553_135
TACGGAGCCGCGGGCGGGAAAGGCG
+FC12044_91407_8_200_553_135
XSQQXXXXXXXXXXSXXMFFQXTKU
@FC12044_91407_8_200_139_74
CCTCCCAGGTTCAAGCGATTATCCT
+FC12044_91407_8_200_139_74
RMXUSXTXXQXXQUXXXSQISISSO
@FC12044_91407_8_200_108_33
GTCATGGCGGCCCGCGCGGGGAGCG
+FC12044_91407_8_200_108_33
OOOSSXXSXXOMKMOFMKFOKFFFF
@FC12044_91407_8_200_980_965
ACAGTGGGTTCTTAAAGAAGAGTCG
+FC12044_91407_8_200_980_965
TOSSRXXXSSMSXMOMXIRXOXFFS
@FC12044_91407_8_200_981_857
AACGAGGGGCGCGACTTGACCTTGG
+FC12044_91407_8_200_981_857
RXMSSXXXXSXQXQXFSXQFQKMXS
@FC12044_91407_8_200_8_865
TTTCCCACCCCAGGAAGCCTTGGAC
+FC12044_91407_8_200_8_865
XXXFKOROMKOORMIMRIIKKORFF
@FC12044_91407_8_200_292_484
TCAGCCTCCGTGCCCAGCCCACTCC
+FC12044_91407_8_200_292_484
XQXOSXXXXXUXXXXIXXXXQTOXF
@FC12044_91407_8_200_675_16
CTCGGGAGGCTGAGGCAGGGGGGTT
+FC12044_91407_8_200_675_16
OXTXXXSXXQXXOXXKMXXMXOKQF
@FC12044_91407_8_200_285_136
CCAAATCTTGAATTGTAGCTCCCCT
+FC12044_91407_8_200_285_136
OSXOQXXXXXSXXUXXTXXXXTRMS
Output file format
The output is a standard EMBOSS alignment file.
The results can be output in one of several styles by using the
command-line qualifier -aformat xxx, where 'xxx' is replaced by the
name of the required format. Some of the alignment formats can cope
with an unlimited number of sequences, while others are only for pairs
of sequences.
The available multiple alignment format names are: multiple, simple,
fasta, msf, clustal, mega, meganon, nexus,, nexusnon, phylip,
phylipnon, selex, treecon, tcoffee, debug, srs.
The available pairwise alignment format names are: pair, markx0,
markx1, markx2, markx3, markx10, match, sam, bam, score, srspair
See: http://emboss.sf.net/docs/themes/AlignFormats.html for further
information on alignment formats.
Output files for usage example
File: needleall.error
Alignment score (21.5) is less than minimum score(40.0) for sequences Illumina_G
enomici_DNA_Adapters1_1 vs FC12044_91407_8_200_406_24
Alignment score (24.5) is less than minimum score(40.0) for sequences Illumina_G
enomic_DNA_Adapters1_2 vs FC12044_91407_8_200_406_24
Alignment score (31.0) is less than minimum score(40.0) for sequences Illumina_G
enomic_DNA_PCR_Primers1_1 vs FC12044_91407_8_200_406_24
Alignment score (25.5) is less than minimum score(40.0) for sequences Illumina_G
enomic_DNA_PCR_Primers1_2 vs FC12044_91407_8_200_406_24
Alignment score (24.5) is less than minimum score(40.0) for sequences Illumina_G
enomic_DNA_sequencing_primer vs FC12044_91407_8_200_406_24
Alignment score (16.5) is less than minimum score(40.0) for sequences Illumina_P
aired_End_DNA_Adapters1_1 vs FC12044_91407_8_200_406_24
Alignment score (24.5) is less than minimum score(40.0) for sequences Illumina_P
aired_End_DNA_Adapters1_2 vs FC12044_91407_8_200_406_24
Alignment score (31.0) is less than minimum score(40.0) for sequences Illumina_P
aired_End_DNA_PCR_Primers1_1 vs FC12044_91407_8_200_406_24
Alignment score (21.0) is less than minimum score(40.0) for sequences Illumina_P
aired_End_DNA_PCR_Primers1_2 vs FC12044_91407_8_200_406_24
Alignment score (24.5) is less than minimum score(40.0) for sequences Illumina_P
aired_End_DNA_sequencing_primer_1 vs FC12044_91407_8_200_406_24
Alignment score (21.0) is less than minimum score(40.0) for sequences Illumina_P
aired_End_DNA_sequencing_primer_2 vs FC12044_91407_8_200_406_24
Alignment score (14.5) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_Adapters1_1 vs FC12044_91407_8_200_406_24
Alignment score (24.5) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_Adapters1_2 vs FC12044_91407_8_200_406_24
Alignment score (12.0) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_Adapters2_1 vs FC12044_91407_8_200_406_24
Alignment score (12.0) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_Adapters2_2 vs FC12044_91407_8_200_406_24
Alignment score (12.0) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_PCR_Primer_1 vs FC12044_91407_8_200_406_24
Alignment score (23.5) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_sequencing_primer vs FC12044_91407_8_200_406_24
Alignment score (12.5) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_Adapters1_1 vs FC12044_91407_8_200_406_24
Alignment score (27.0) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_Adapters1_2 vs FC12044_91407_8_200_406_24
Alignment score (12.0) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_Adapters2_1 vs FC12044_91407_8_200_406_24
Alignment score (12.0) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_Adapters2_2 vs FC12044_91407_8_200_406_24
Alignment score (12.0) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_PCR_Primer_1 vs FC12044_91407_8_200_406_24
Alignment score (27.5) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_sequencing_primer vs FC12044_91407_8_200_406_24
Alignment score (12.0) is less than minimum score(40.0) for sequences Illumina_S
mall_RNA_RT_Primer vs FC12044_91407_8_200_406_24
Alignment score (23.5) is less than minimum score(40.0) for sequences Illumina_S
mall_RNA_5p_Adapter vs FC12044_91407_8_200_406_24
Alignment score (13.0) is less than minimum score(40.0) for sequences Illumina_S
mall_RNA_3p_Adapter vs FC12044_91407_8_200_406_24
Alignment score (12.0) is less than minimum score(40.0) for sequences Illumina_S
mall_RNA_PCR_Primer_1 vs FC12044_91407_8_200_406_24
Alignment score (23.5) is less than minimum score(40.0) for sequences Illumina_S
mall_RNA_sequencing_primer vs FC12044_91407_8_200_406_24
Alignment score (17.5) is less than minimum score(40.0) for sequences Illumina_G
enomici_DNA_Adapters1_1 vs FC12044_91407_8_200_720_610
Alignment score (31.5) is less than minimum score(40.0) for sequences Illumina_G
enomic_DNA_Adapters1_2 vs FC12044_91407_8_200_720_610
Alignment score (31.5) is less than minimum score(40.0) for sequences Illumina_G
enomic_DNA_PCR_Primers1_1 vs FC12044_91407_8_200_720_610
Alignment score (20.5) is less than minimum score(40.0) for sequences Illumina_G
enomic_DNA_PCR_Primers1_2 vs FC12044_91407_8_200_720_610
Alignment score (31.5) is less than minimum score(40.0) for sequences Illumina_G
enomic_DNA_sequencing_primer vs FC12044_91407_8_200_720_610
Alignment score (0.0) is less than minimum score(40.0) for sequences Illumina_Pa
ired_End_DNA_Adapters1_1 vs FC12044_91407_8_200_720_610
Alignment score (31.5) is less than minimum score(40.0) for sequences Illumina_P
aired_End_DNA_Adapters1_2 vs FC12044_91407_8_200_720_610
Alignment score (31.5) is less than minimum score(40.0) for sequences Illumina_P
aired_End_DNA_PCR_Primers1_1 vs FC12044_91407_8_200_720_610
Alignment score (33.5) is less than minimum score(40.0) for sequences Illumina_P
aired_End_DNA_PCR_Primers1_2 vs FC12044_91407_8_200_720_610
Alignment score (31.5) is less than minimum score(40.0) for sequences Illumina_P
aired_End_DNA_sequencing_primer_1 vs FC12044_91407_8_200_720_610
Alignment score (33.5) is less than minimum score(40.0) for sequences Illumina_P
aired_End_DNA_sequencing_primer_2 vs FC12044_91407_8_200_720_610
Alignment score (20.0) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_Adapters1_1 vs FC12044_91407_8_200_720_610
Alignment score (9.0) is less than minimum score(40.0) for sequences Illumina_Dp
nII_Gex_Adapters1_2 vs FC12044_91407_8_200_720_610
Alignment score (11.0) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_Adapters2_1 vs FC12044_91407_8_200_720_610
Alignment score (15.5) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_Adapters2_2 vs FC12044_91407_8_200_720_610
Alignment score (11.0) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_PCR_Primer_1 vs FC12044_91407_8_200_720_610
Alignment score (10.0) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_PCR_Primer_2 vs FC12044_91407_8_200_720_610
Alignment score (15.0) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_sequencing_primer vs FC12044_91407_8_200_720_610
Alignment score (20.0) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_Adapters1_1 vs FC12044_91407_8_200_720_610
Alignment score (9.5) is less than minimum score(40.0) for sequences Illumina_Nl
aIII_Gex_Adapters1_2 vs FC12044_91407_8_200_720_610
Alignment score (7.0) is less than minimum score(40.0) for sequences Illumina_Nl
aIII_Gex_Adapters2_1 vs FC12044_91407_8_200_720_610
Alignment score (15.5) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_Adapters2_2 vs FC12044_91407_8_200_720_610
[Part of this file has been deleted for brevity]
Alignment score (13.0) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_Adapters1_1 vs FC12044_91407_8_200_675_16
Alignment score (17.0) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_Adapters1_2 vs FC12044_91407_8_200_675_16
Alignment score (13.5) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_Adapters2_1 vs FC12044_91407_8_200_675_16
Alignment score (11.0) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_Adapters2_2 vs FC12044_91407_8_200_675_16
Alignment score (13.5) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_PCR_Primer_1 vs FC12044_91407_8_200_675_16
Alignment score (17.5) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_PCR_Primer_2 vs FC12044_91407_8_200_675_16
Alignment score (22.0) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_sequencing_primer vs FC12044_91407_8_200_675_16
Alignment score (13.0) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_Adapters1_1 vs FC12044_91407_8_200_675_16
Alignment score (17.0) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_Adapters1_2 vs FC12044_91407_8_200_675_16
Alignment score (13.5) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_Adapters2_1 vs FC12044_91407_8_200_675_16
Alignment score (11.0) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_Adapters2_2 vs FC12044_91407_8_200_675_16
Alignment score (13.5) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_PCR_Primer_1 vs FC12044_91407_8_200_675_16
Alignment score (17.5) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_PCR_Primer_2 vs FC12044_91407_8_200_675_16
Alignment score (21.5) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_sequencing_primer vs FC12044_91407_8_200_675_16
Alignment score (13.5) is less than minimum score(40.0) for sequences Illumina_S
mall_RNA_RT_Primer vs FC12044_91407_8_200_675_16
Alignment score (15.0) is less than minimum score(40.0) for sequences Illumina_S
mall_RNA_5p_Adapter vs FC12044_91407_8_200_675_16
Alignment score (7.0) is less than minimum score(40.0) for sequences Illumina_Sm
all_RNA_3p_Adapter vs FC12044_91407_8_200_675_16
Alignment score (13.5) is less than minimum score(40.0) for sequences Illumina_S
mall_RNA_PCR_Primer_1 vs FC12044_91407_8_200_675_16
Alignment score (17.5) is less than minimum score(40.0) for sequences Illumina_S
mall_RNA_PCR_Primer_2 vs FC12044_91407_8_200_675_16
Alignment score (22.0) is less than minimum score(40.0) for sequences Illumina_S
mall_RNA_sequencing_primer vs FC12044_91407_8_200_675_16
Alignment score (21.0) is less than minimum score(40.0) for sequences Illumina_G
enomici_DNA_Adapters1_1 vs FC12044_91407_8_200_285_136
Alignment score (17.5) is less than minimum score(40.0) for sequences Illumina_G
enomic_DNA_Adapters1_2 vs FC12044_91407_8_200_285_136
Alignment score (30.0) is less than minimum score(40.0) for sequences Illumina_G
enomic_DNA_PCR_Primers1_1 vs FC12044_91407_8_200_285_136
Alignment score (16.5) is less than minimum score(40.0) for sequences Illumina_G
enomic_DNA_PCR_Primers1_2 vs FC12044_91407_8_200_285_136
Alignment score (17.5) is less than minimum score(40.0) for sequences Illumina_G
enomic_DNA_sequencing_primer vs FC12044_91407_8_200_285_136
Alignment score (7.0) is less than minimum score(40.0) for sequences Illumina_Pa
ired_End_DNA_Adapters1_1 vs FC12044_91407_8_200_285_136
Alignment score (17.5) is less than minimum score(40.0) for sequences Illumina_P
aired_End_DNA_Adapters1_2 vs FC12044_91407_8_200_285_136
Alignment score (30.0) is less than minimum score(40.0) for sequences Illumina_P
aired_End_DNA_PCR_Primers1_1 vs FC12044_91407_8_200_285_136
Alignment score (21.0) is less than minimum score(40.0) for sequences Illumina_P
aired_End_DNA_PCR_Primers1_2 vs FC12044_91407_8_200_285_136
Alignment score (17.5) is less than minimum score(40.0) for sequences Illumina_P
aired_End_DNA_sequencing_primer_1 vs FC12044_91407_8_200_285_136
Alignment score (18.5) is less than minimum score(40.0) for sequences Illumina_P
aired_End_DNA_sequencing_primer_2 vs FC12044_91407_8_200_285_136
Alignment score (27.5) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_Adapters1_1 vs FC12044_91407_8_200_285_136
Alignment score (13.5) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_Adapters1_2 vs FC12044_91407_8_200_285_136
Alignment score (6.0) is less than minimum score(40.0) for sequences Illumina_Dp
nII_Gex_Adapters2_1 vs FC12044_91407_8_200_285_136
Alignment score (17.5) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_Adapters2_2 vs FC12044_91407_8_200_285_136
Alignment score (6.0) is less than minimum score(40.0) for sequences Illumina_Dp
nII_Gex_PCR_Primer_1 vs FC12044_91407_8_200_285_136
Alignment score (12.0) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_PCR_Primer_2 vs FC12044_91407_8_200_285_136
Alignment score (17.5) is less than minimum score(40.0) for sequences Illumina_D
pnII_Gex_sequencing_primer vs FC12044_91407_8_200_285_136
Alignment score (26.5) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_Adapters1_1 vs FC12044_91407_8_200_285_136
Alignment score (14.5) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_Adapters1_2 vs FC12044_91407_8_200_285_136
Alignment score (2.0) is less than minimum score(40.0) for sequences Illumina_Nl
aIII_Gex_Adapters2_1 vs FC12044_91407_8_200_285_136
Alignment score (17.5) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_Adapters2_2 vs FC12044_91407_8_200_285_136
Alignment score (6.0) is less than minimum score(40.0) for sequences Illumina_Nl
aIII_Gex_PCR_Primer_1 vs FC12044_91407_8_200_285_136
Alignment score (12.0) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_PCR_Primer_2 vs FC12044_91407_8_200_285_136
Alignment score (15.5) is less than minimum score(40.0) for sequences Illumina_N
laIII_Gex_sequencing_primer vs FC12044_91407_8_200_285_136
Alignment score (6.0) is less than minimum score(40.0) for sequences Illumina_Sm
all_RNA_RT_Primer vs FC12044_91407_8_200_285_136
Alignment score (15.5) is less than minimum score(40.0) for sequences Illumina_S
mall_RNA_5p_Adapter vs FC12044_91407_8_200_285_136
Alignment score (17.5) is less than minimum score(40.0) for sequences Illumina_S
mall_RNA_3p_Adapter vs FC12044_91407_8_200_285_136
Alignment score (6.0) is less than minimum score(40.0) for sequences Illumina_Sm
all_RNA_PCR_Primer_1 vs FC12044_91407_8_200_285_136
Alignment score (12.0) is less than minimum score(40.0) for sequences Illumina_S
mall_RNA_PCR_Primer_2 vs FC12044_91407_8_200_285_136
Alignment score (17.5) is less than minimum score(40.0) for sequences Illumina_S
mall_RNA_sequencing_primer vs FC12044_91407_8_200_285_136
The Identity: is the percentage of identical matches between the two
sequences over the reported aligned region (including any gaps in the
length).
The Similarity: is the percentage of matches between the two sequences
over the reported aligned region (including any gaps in the length).
Data files
For protein sequences EBLOSUM62 is used for the substitution matrix.
For nucleotide sequence, EDNAFULL is used. Others can be specified.
EMBOSS data files are distributed with the application and stored in
the standard EMBOSS data directory, which is defined by the EMBOSS
environment variable EMBOSS_DATA.
To see the available EMBOSS data files, run:
% embossdata -showall
To fetch one of the data files (for example 'Exxx.dat') into your
current directory for you to inspect or modify, run:
% embossdata -fetch -file Exxx.dat
Users can provide their own data files in their own directories.
Project specific files can be put in the current directory, or for
tidier directory listings in a subdirectory called ".embossdata". Files
for all EMBOSS runs can be put in the user's home directory, or again
in a subdirectory called ".embossdata".
The directories are searched in the following order:
* . (your current directory)
* .embossdata (under your current directory)
* ~/ (your home directory)
* ~/.embossdata
Notes
needleall is a true implementation of the Needleman-Wunsch algorithm
and so produces a full path matrix. It therefore cannot be used with
genome sized sequences unless you've a lot of memory and a lot of time.
References
1. Needleman, S. B. and Wunsch, C. D. (1970) J. Mol. Biol. 48,
443-453.
2. Kruskal, J. B. (1983) An overview of squence comparison In D.
Sankoff and J. B. Kruskal, (ed.), Time warps, string edits and
macromolecules: the theory and practice of sequence comparison, pp.
1-44 Addison Wesley.
Warnings
needleall is for aligning pairs of sequences over their entire length.
This works best with closely related sequences. If you use needleall to
align very distantly-related sequences, it will produce a result but
much of the alignment may have little or no biological significance.
A true Needleman Wunsch implementation like needleall needs memory
proportional to the product of the sequence lengths. For two sequences
of length 10,000,000 and 1,000 it therefore needs memory proportional
to 10,000,000,000 characters. Two arrays of this size are produced, one
of ints and one of floats so multiply that figure by 8 to get the
memory usage in bytes. That doesn't include other overheads. Therefore
only use water and needle for accurate alignment of reasonably short
sequences.
The first input sequence set is loaded completely into memory. When
comparing large numbers (or lengths) of sequences, the smallest set
should be the first input to make the most efficient use of memory.
If you run out of memory, try using stretcher instead.
Diagnostic Error Messages
Uncaught exception
Assertion failed
raised at ajmem.c:xxx
Probably means you have run out of memory. Try using stretcher if this
happens.
Exit status
0 upon successful completion.
Known bugs
None.
See also
Program name Description
est2genome Align EST sequences to genomic DNA sequence
needle Needleman-Wunsch global alignment of two sequences
stretcher Needleman-Wunsch rapid global alignment of two sequences
When you want an alignment that covers the whole length of two
sequences, use needle.
When you are trying to find the best region of similarity between two
sequences, use water.
stretcher is a more suitable program to use to find global alignments
of very long sequences.
Author(s)
Mahmut Uludag
European Bioinformatics Institute, Wellcome Trust Genome Campus,
Hinxton, Cambridge CB10 1SD, UK
Please report all bugs to the EMBOSS bug team
(emboss-bug (c) emboss.open-bio.org) not to the original author.
History
Target users
This program is intended to be used by everyone and everything, from
naive users to embedded scripts.
Comments
None