remap
Wiki
The master copies of EMBOSS documentation are available at
http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.
Please help by correcting and extending the Wiki pages.
Function
Display restriction enzyme binding sites in a nucleotide sequence
Description
remap scans one or more nucleotide sequences for recognition sites
and/or cut sites for a supplied set of restriction enzymes. One or more
restriction enzymes can be specified or alternatively all the enzymes
in the REBASE database can be investigated. The minimum length of a
recognition site to be reported must be specified. It writes an output
file showing the location of the cut sites and (optionally) the
recognition sites. Sites on both strands are shown by default but there
are many options to control exactly what sites are reported and the
format of the output file. Optionally, the translated sequence is
reported. Additionally, the output file lists enzymess that cut / do
not cut the sequence and which match / do not matching certain
specified criteria.
Usage
Here is a sample session with remap
This example uses only a small region of the input sequence to save
space. This is run with a small test version of the restriction enzyme
database and so you will probably see more enzymes when you run this.
% remap -notran -sbeg 1 -send 60
Display restriction enzyme binding sites in a nucleotide sequence
Input nucleotide sequence(s): tembl:j01636
Comma separated enzyme list [all]: taqi,bsu6i,acii,bsski
Minimum recognition site length [4]:
Output file [j01636.remap]:
Go to the input files for this example
Go to the output files for this example
Example 2
This is an example where all enzymes in the REBASE database are used,
(but only the prototypes of the isoschizomers are reported by default).
This is run with a small test version of the restriction enzyme
database and so you will probably see more enzymes when you run this.
% remap -notran -sbeg 1 -send 60
Display restriction enzyme binding sites in a nucleotide sequence
Input nucleotide sequence(s): tembl:j01636
Comma separated enzyme list [all]:
Minimum recognition site length [4]:
Output file [j01636.remap]:
Go to the output files for this example
Example 3
This is an example where all enzymes in the REBASE database are used
but the -limit qualifier is not set so that all of the enzymes are
displayed and not just only the prototypes of the isoschizomers. This
is run with a small test version of the restriction enzyme database and
so you will probably see more enzymes when you run this.
% remap -notran -sbeg 1 -send 60 -nolimit
Display restriction enzyme binding sites in a nucleotide sequence
Input nucleotide sequence(s): tembl:j01636
Comma separated enzyme list [all]:
Minimum recognition site length [4]:
Output file [j01636.remap]:
Go to the output files for this example
Example 4
This shows the 'flat' format: This is run with a small test version of
the restriction enzyme database and so you will probably see more
enzymes when you run this.
% remap -notran -sbeg 1 -send 60 -flat
Display restriction enzyme binding sites in a nucleotide sequence
Input nucleotide sequence(s): tembl:j01636
Comma separated enzyme list [all]:
Minimum recognition site length [4]:
Output file [j01636.remap]:
Go to the output files for this example
Command line arguments
Display restriction enzyme binding sites in a nucleotide sequence
Version: EMBOSS:6.6.0.0
Standard (Mandatory) qualifiers:
[-sequence] seqall Nucleotide sequence(s) filename and optional
format, or reference (input USA)
-enzymes string [all] The name 'all' reads in all enzyme
names from the REBASE database. You can
specify enzymes by giving their names with
commas between then, such as:
'HincII,hinfI,ppiI,hindiii'.
The case of the names is not important. You
can specify a file of enzyme names to read
in by giving the name of the file holding
the enzyme names with a '@' character in
front of it, for example, '@enz.list'.
Blank lines and lines starting with a hash
character or '!' are ignored and all other
lines are concatenated together with a comma
character ',' and then treated as the list
of enzymes to search for.
An example of a file of enzyme names is:
! my enzymes
HincII, ppiII
! other enzymes
hindiii
HinfI
PpiI (Any string)
-sitelen integer [4] This sets the minimum length of the
restriction enzyme recognition site. Any
enzymes with sites shorter than this will be
ignored. (Integer from 2 to 20)
[-outfile] outfile [*.remap] Output file name
Additional (Optional) qualifiers:
-mincuts integer [1] This sets the minimum number of cuts for
any restriction enzyme that will be
considered. Any enzymes that cut fewer times
than this will be ignored. (Integer from 1
to 1000)
-maxcuts integer [2000000000] This sets the maximum number of
cuts for any restriction enzyme that will
be considered. Any enzymes that cut more
times than this will be ignored. (Any
integer value)
-single boolean [N] If this is set then this forces the
values of the mincuts and maxcuts qualifiers
to both be 1. Any other value you may have
set them to will be ignored.
-[no]blunt boolean [Y] This allows those enzymes which cut at
the same position on the forward and reverse
strands to be considered.
-[no]sticky boolean [Y] This allows those enzymes which cut at
different positions on the forward and
reverse strands, leaving an overhang, to be
considered.
-[no]ambiguity boolean [Y] This allows those enzymes which have one
or more 'N' ambiguity codes in their
pattern to be considered
-plasmid boolean [N] If this is set then this allows searches
for restriction enzyme recognition site and
cut positions that span the end of the
sequence to be considered.
-methylation boolean [N] If this is set then RE recognition sites
will not match methylated bases.
-[no]commercial boolean [Y] If this is set, then only those enzymes
with a commercial supplier will be searched
for. This qualifier is ignored if you have
specified an explicit list of enzymes to
search for, rather than searching through
'all' the enzymes in the REBASE database. It
is assumed that, if you are asking for an
explicit enzyme, then you probably know
where to get it from and so all enzymes
names that you have asked to be searched
for, and which cut, will be reported whether
or not they have a commercial supplier.
-table menu [0] Genetic code to use (Values: 0
(Standard); 1 (Standard (with alternative
initiation codons)); 2 (Vertebrate
Mitochondrial); 3 (Yeast Mitochondrial); 4
(Mold, Protozoan, Coelenterate Mitochondrial
and Mycoplasma/Spiroplasma); 5
(Invertebrate Mitochondrial); 6 (Ciliate
Macronuclear and Dasycladacean); 9
(Echinoderm Mitochondrial); 10 (Euplotid
Nuclear); 11 (Bacterial); 12 (Alternative
Yeast Nuclear); 13 (Ascidian Mitochondrial);
14 (Flatworm Mitochondrial); 15
(Blepharisma Macronuclear); 16
(Chlorophycean Mitochondrial); 21 (Trematode
Mitochondrial); 22 (Scenedesmus obliquus);
23 (Thraustochytrium Mitochondrial))
-frame menu [6] This allows you to specify the frames
that are translated. If you are not
displaying cut sites on the reverse sense,
then the reverse sense translations will not
be displayed even if you have requested
frames 4, 5 or 6. By default, all six frames
will be displayed. (Values: 1 (1); 2 (2); 3
(3); F (Forward three frames); -1 (-1); -2
(-2); -3 (-3); R (Reverse three frames); 6
(All six frames))
-[no]cutlist boolean [Y] This produces lists in the output of the
enzymes that cut, those that cut but are
excluded because that cut fewer times than
mincut or more times than maxcut and those
enzymes that do not cut.
-flatreformat boolean [N] This changes the output format to one
where the recognition site is indicated by a
row of '===' characters and the cut site is
pointed to by a '>' character in the
forward sense, or a '<' in the reverse sense
strand.
-[no]limit boolean [Y] This limits the reporting of enzymes to
just one enzyme from each group of
isoschizomers. The enzyme chosen to
represent an isoschizomer group is the
prototype indicated in the data file
'embossre.equ', which is created by the
program 'rebaseextract'. If you prefer
different prototypes to be used, make a copy
of embossre.equ in your home directory and
edit it. If this value is set to be false
then all of the input enzymes will be
reported. You might like to set this to
false if you are supplying an explicit set
of enzymes rather than searching 'all' of
them.
Advanced (Unprompted) qualifiers:
-mfile datafile [Emethylsites.dat] Restriction enzyme
methylation data file
-[no]translation boolean [Y] This displays the 6-frame translations
of the sequence in the output.
-[no]reverse boolean [Y] This displays the cut sites and
translation of the reverse sense.
-orfminsize integer [If this value is left as 0 then all of the
translation is shown.] This sets the minimum
size of Open Reading Frames (ORFs) to
display in the translations. All other
translation regions are masked by changing
the amino acids to '-' characters. (Integer
0 or more)
-uppercase range [If this is left blank, then the sequence
case is left alone.] Regions to put in
uppercase.
If this is left blank, then the sequence
case is left alone.
A set of regions is specified by a set of
pairs of positions.
The positions are integers.
They are separated by any non-digit,
non-alpha character.
Examples of region specifications are:
24-45, 56-78
1:45, 67=99;765..888
1,5,8,10,23,45,57,99
-highlight range [(full sequence)] Regions to colour if
formatting for HTML.
If this is left blank, then the sequence is
left alone.
A set of regions is specified by a set of
pairs of positions.
The positions are integers.
They are followed by any valid HTML font
colour.
Examples of region specifications are:
24-45 blue 56-78 orange
1-100 green 120-156 red
A file of ranges to colour (one range per
line) can be specified as '@filename'.
-threeletter boolean [N] Display protein sequences in
three-letter code
-number boolean [N] Number the sequences
-width integer [60] Width of sequence to display (Integer 1
or more)
-length integer [0] Line length of page (0 for indefinite)
(Integer 0 or more)
-margin integer [10] Margin around sequence for numbering
(Integer 0 or more)
-[no]name boolean [Y] Set this to be false if you do not wish
to display the ID name of the sequence
-[no]description boolean [Y] Set this to be false if you do not wish
to display the description of the sequence
-offset integer [1] Offset to start numbering the sequence
from (Any integer value)
-html boolean [N] Use HTML formatting
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-scircular1 boolean Sequence is circular
-squick1 boolean Read id and sequence only
-sformat1 string Input sequence format
-iquery1 string Input query fields or ID list
-ioffset1 integer Input start position offset
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
Input file format
Input files for usage example
'tembl:j01636' is a sequence entry in the example nucleic acid database
'tembl'
Database entry: tembl:j01636
ID J01636; SV 1; linear; genomic DNA; STD; PRO; 7477 BP.
XX
AC J01636; J01637; K01483; K01793;
XX
DT 30-NOV-1990 (Rel. 26, Created)
DT 09-SEP-2004 (Rel. 81, Last updated, Version 8)
XX
DE E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
XX
KW acetyltransferase; beta-D-galactosidase; galactosidase; lac operon;
KW lac repressor protein; lacA gene; lacI gene; lactose permease; lacY gene;
KW lacZ gene; mutagenesis; palindrome; promoter region;
KW thiogalactoside acetyltransferase.
XX
OS Escherichia coli
OC Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
OC Enterobacteriaceae; Escherichia.
XX
RN [1]
RP 1243-1266
RX DOI; 10.1073/pnas.70.12.3581.
RX PUBMED; 4587255.
RA Gilbert W., Maxam A.;
RT "The nucleotide sequence of the lac operator";
RL Proc. Natl. Acad. Sci. U.S.A. 70(12):3581-3584(1973).
XX
RN [2]
RP 1246-1308
RX DOI; 10.1073/pnas.70.12.3585.
RX PUBMED; 4587256.
RA Maizels N.M.;
RT "The nucleotide sequence of the lactose messenger ribonucleic acid
RT transcribed from the UV5 promoter mutant of Escherichia coli";
RL Proc. Natl. Acad. Sci. U.S.A. 70(12):3585-3589(1973).
XX
RN [3]
RX PUBMED; 4598642.
RA Gilbert W., Maizels N., Maxam A.;
RT "Sequences of controlling regions of the lactose operon";
RL Cold Spring Harb. Symp. Quant. Biol. 38:845-855(1974).
XX
RN [4]
RA Gilbert W., Gralla J., Majors A.J., Maxam A.;
RT "Lactose operator sequences and the action of lac repressor";
RL (in) Sund H., Blauer G. (Eds.);
RL PROTEIN-LIGAND INTERACTIONS:193-207;
RL Walter de Gruyter, New York (1975)
XX
RN [5]
RP 1146-1282
[Part of this file has been deleted for brevity]
cgatttggct acatgacatc aaccatatca gcaaaagtga tacgggtatt atttttgccg 4560
ctatttctct gttctcgcta ttattccaac cgctgtttgg tctgctttct gacaaactcg 4620
ggctgcgcaa atacctgctg tggattatta ccggcatgtt agtgatgttt gcgccgttct 4680
ttatttttat cttcgggcca ctgttacaat acaacatttt agtaggatcg attgttggtg 4740
gtatttatct aggcttttgt tttaacgccg gtgcgccagc agtagaggca tttattgaga 4800
aagtcagccg tcgcagtaat ttcgaatttg gtcgcgcgcg gatgtttggc tgtgttggct 4860
gggcgctgtg tgcctcgatt gtcggcatca tgttcaccat caataatcag tttgttttct 4920
ggctgggctc tggctgtgca ctcatcctcg ccgttttact ctttttcgcc aaaacggatg 4980
cgccctcttc tgccacggtt gccaatgcgg taggtgccaa ccattcggca tttagcctta 5040
agctggcact ggaactgttc agacagccaa aactgtggtt tttgtcactg tatgttattg 5100
gcgtttcctg cacctacgat gtttttgacc aacagtttgc taatttcttt acttcgttct 5160
ttgctaccgg tgaacagggt acgcgggtat ttggctacgt aacgacaatg ggcgaattac 5220
ttaacgcctc gattatgttc tttgcgccac tgatcattaa tcgcatcggt gggaaaaacg 5280
ccctgctgct ggctggcact attatgtctg tacgtattat tggctcatcg ttcgccacct 5340
cagcgctgga agtggttatt ctgaaaacgc tgcatatgtt tgaagtaccg ttcctgctgg 5400
tgggctgctt taaatatatt accagccagt ttgaagtgcg tttttcagcg acgatttatc 5460
tggtctgttt ctgcttcttt aagcaactgg cgatgatttt tatgtctgta ctggcgggca 5520
atatgtatga aagcatcggt ttccagggcg cttatctggt gctgggtctg gtggcgctgg 5580
gcttcacctt aatttccgtg ttcacgctta gcggccccgg cccgctttcc ctgctgcgtc 5640
gtcaggtgaa tgaagtcgct taagcaatca atgtcggatg cggcgcgacg cttatccgac 5700
caacatatca taacggagtg atcgcattga acatgccaat gaccgaaaga ataagagcag 5760
gcaagctatt taccgatatg tgcgaaggct taccggaaaa aagacttcgt gggaaaacgt 5820
taatgtatga gtttaatcac tcgcatccat cagaagttga aaaaagagaa agcctgatta 5880
aagaaatgtt tgccacggta ggggaaaacg cctgggtaga accgcctgtc tatttctctt 5940
acggttccaa catccatata ggccgcaatt tttatgcaaa tttcaattta accattgtcg 6000
atgactacac ggtaacaatc ggtgataacg tactgattgc acccaacgtt actctttccg 6060
ttacgggaca ccctgtacac catgaattga gaaaaaacgg cgagatgtac tcttttccga 6120
taacgattgg caataacgtc tggatcggaa gtcatgtggt tattaatcca ggcgtcacca 6180
tcggggataa ttctgttatt ggcgcgggta gtatcgtcac aaaagacatt ccaccaaacg 6240
tcgtggcggc tggcgttcct tgtcgggtta ttcgcgaaat aaacgaccgg gataagcact 6300
attatttcaa agattataaa gttgaatcgt cagtttaaat tataaaaatt gcctgatacg 6360
ctgcgcttat caggcctaca agttcagcga tctacattag ccgcatccgg catgaacaaa 6420
gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt 6480
gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc 6540
atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg 6600
atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca 6660
gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac 6720
accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc 6780
agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca 6840
ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg 6900
tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg 6960
taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc 7020
acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac 7080
caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg 7140
tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca 7200
gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca 7260
ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag 7320
cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag 7380
actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc 7440
cagcccgccc atggtaacca ccggcagagc ggtcgac 7477
//
You can specify a file of ranges to display in uppercase by giving the
'-uppercase' qualifier the value '@' followed by the name of the file
containing the ranges. (eg: '-upper @myfile').
The format of the range file is:
* Comment lines start with '#' in the first column.
* Comment lines and blank lines are ignored.
* The line may start with white-space.
* There are two positive (integer) numbers per line separated by one
or more space or TAB characters.
* The second number must be greater or equal to the first number.
* There can be optional text after the two numbers to annotate the
line.
* White-space before or after the text is removed.
An example range file is:
# this is my set of ranges
12 23
4 5 this is like 12-23, but smaller
67 10348 interesting region
You can specify a file of ranges to highlight in a different colour
when outputting in HTML format (using the '-html' qualifier) by giving
the '-highlight' qualifier the value '@' followed by the name of the
file containing the ranges. (eg: '-highlight @myfile').
The format of this file is very similar to the format of the above
uppercase range file, except that the text after the start and end
positions is used as the HTML colour name. This colour name is used 'as
is' when specifying the colour in HTML in a '<FONT COLOR=xxx>'
construct, (where 'xxx' is the name of the colour).
The standard names of HTML font colours are given in:
http://http://www.w3.org/TR/REC-html40/types.html#h-6.5
An example highlight range file is:
__________________________________________________________________
# this is my set of ranges
12 23 red
4 5 darkturquoise
67 10348 #FFE4E1
__________________________________________________________________
Output file format
Output files for usage example
File: j01636.remap
J01636
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
BssKI
TaqI AciI Ksp632I
\ \ \
gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt
10 20 30 40 50 60
----:----|----:----|----:----|----:----|----:----|----:----|
ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca
/ / / /
TaqI AciI | BssKI
Ksp632I
# Enzymes that cut Frequency Isoschizomers
AciI 1
BssKI 1
Ksp632I 1 Bsu6I
TaqI 1
# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency Isoschizomers
# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency Isoschizomers
# Enzymes that do not cut
# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria
0
Output files for usage example 2
File: j01636.remap
J01636
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
Hin6I
TaqI | HhaI
| BsiYI | BssKI
| | Hin6I | Ksp632I
| | | HhaI AciI | | HpaII
\ \ \ \ \ \ \ \
gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt
10 20 30 40 50 60
----:----|----:----|----:----|----:----|----:----|----:----|
ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca
/ / / / / / / ///
| TaqI | Hin6I AciI | | ||BssKI
BsiYI HhaI | | |HpaII
| | Ksp632I
| Hin6I
HhaI
# Enzymes that cut Frequency Isoschizomers
AciI 1
BsiYI 1 Bsc4I
BssKI 1
HhaI 2
Hin6I 2 HinP1I,HspAI
HpaII 1 BsiSI
Ksp632I 1 Bsu6I
TaqI 1
# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency Isoschizomers
# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency Isoschizomers
# Enzymes that do not cut
AclI BamHI BceAI BseYI BsrI ClaI EcoRI EcoRII
HaeIII Hin4I HindII HindIII KpnI MaeII NotI
# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria
0
Output files for usage example 3
File: j01636.remap
J01636
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
HspAI
Hin6I
TaqI HinP1I
| BsiYI | HhaI
| Bsc4I | BssKI
| | HspAI | Bsu6I
| | Hin6I | Ksp632I
| | HinP1I | | HpaII
| | | HhaI AciI | | BsiSI
\ \ \ \ \ \ \ \
gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt
10 20 30 40 50 60
----:----|----:----|----:----|----:----|----:----|----:----|
ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca
/ / / / / / / ///
| TaqI | HinP1I AciI | | ||BssKI
Bsc4I | Hin6I | | |BsiSI
BsiYI | HspAI | | |HpaII
HhaI | | Ksp632I
| | Bsu6I
| HinP1I
| Hin6I
| HspAI
HhaI
# Enzymes that cut Frequency
AciI 1
Bsc4I 1
BsiSI 1
BsiYI 1
BssKI 1
Bsu6I 1
HhaI 2
Hin6I 2
HinP1I 2
HpaII 1
HspAI 2
Ksp632I 1
TaqI 1
# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency
# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency
# Enzymes that do not cut
AclI BamHI BceAI Bse1I BseYI BshI BsrI ClaI
EcoRI EcoRII HaeIII Hin4I HindII HindIII HpyCH4IV KpnI
MaeII NotI
# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria
0
Output files for usage example 4
File: j01636.remap
J01636
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
HpaII
>===
BssKI
>=====
HhaI HhaI
==>= ==>=
TaqI Hin6I Hin6I
>=== >=== >===
BsiYI AciI Ksp632I
======>==== >..==== >.........====
gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt
10 20 30 40 50 60
----:----|----:----|----:----|----:----|----:----|----:----|
ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca
====<====== <=== ===< .....====
BsiYI AciI Hin6I Ksp632I
===< ===< =<==
TaqI Hin6I HhaI
=<== =====<
HhaI BssKI
===<
HpaII
# Enzymes that cut Frequency Isoschizomers
AciI 1
BsiYI 1 Bsc4I
BssKI 1
HhaI 2
Hin6I 2 HinP1I,HspAI
HpaII 1 BsiSI
Ksp632I 1 Bsu6I
TaqI 1
# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency Isoschizomers
# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency Isoschizomers
# Enzymes that do not cut
AclI BamHI BceAI BseYI BsrI ClaI EcoRI EcoRII
HaeIII Hin4I HindII HindIII KpnI MaeII NotI
# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria
0
The name of the sequence is displayed, followed by the description of
the sequence.
The formatted display of cut sites on the sequence follows, with the
six-frame translation below it. The cut sites are indicated by a slash
character '\' that points to the poition between the nucleotides where
the cuts occur. Cuts by many enzymes at the same position are indicated
by stacking the enzyme names on top of each other.
At the end the section header 'Enzymes that cut' is displayed followed
by a list of the enzymes that cut the specified sequence and the number
of times that they cut. For each enzyme that cuts, a list of
isoschizomers of that enzyme (sharing the same recognition site pattern
and cut sites) is given.
This is followed by lists of the enzymes that do cut, but which cut
less often than the '-mincut' qualifier or more often than the
'-maxcut' qualifier.
Any of the isoschizomers that are excluded from cutting, (either
through restrictions such as the permitted number of cuts, blunt
cutters only, single cutters only etc. or because their name has not
been given in the input list of enzymes), will not be listed.
Then a list is displayed of the enzymes whose names were input and
which match the other criteria ('-sitelen', '-blunt', '-sticky',
'-ambiguity' or '-commercial') but which do not cut.
Finally the number of enzymes that were rejected from consideration
because they do not match the '-sitelen', '-blunt', '-sticky',
'-ambiguity' or '-commercial' criteria is displayed.
The '-flatreformat' qualifier changes the display to emphasise the
recognition site of the restriction enzyme, which is indicated by a row
of '=' characters. The cut site if pointed to by a '>' or '<' character
and if the cut site is not within or imemdiately adjacent to the
recognition site, they are linked by a row of '.' characters.
The name of the enzyme is displayed above (or below when the reverse
sense site if displayed) the recognition site. The name of the enzyme
is also displayed above the cut site if this occurs on a different
display line to the recognition site (i.e. if it wraps onto the next
line of sequence).
Data files
EMBOSS data files are distributed with the application and stored in
the standard EMBOSS data directory, which is defined by the EMBOSS
environment variable EMBOSS_DATA.
To see the available EMBOSS data files, run:
% embossdata -showall
To fetch one of the data files (for example 'Exxx.dat') into your
current directory for you to inspect or modify, run:
% embossdata -fetch -file Exxx.dat
Users can provide their own data files in their own directories.
Project specific files can be put in the current directory, or for
tidier directory listings in a subdirectory called ".embossdata". Files
for all EMBOSS runs can be put in the user's home directory, or again
in a subdirectory called ".embossdata".
The directories are searched in the following order:
* . (your current directory)
* .embossdata (under your current directory)
* ~/ (your home directory)
* ~/.embossdata
The EMBOSS REBASE restriction enzyme data files are stored in directory
'data/REBASE/*' under the EMBOSS installation directory.
These files must first be set up using the program 'rebaseextract'.
Running 'rebaseextract' may be the job of your system manager.
The data files are stored in the REBASE directory of the standard
EMBOSS data directory. The names are:
* embossre.enz Cleavage information
* embossre.ref Reference/methylation information
* embossre.sup Supplier information
The column information is described at the top of the data files
The reported enzyme from any one group of isoschizomers (the prototype)
is specified in the REBASE database and the information is held in the
data file 'embossre.equ'. You may edit this file to set your own
preferred prototype, if you wish.
The format of the file "embossre.equ" is
Enzyme-name Prototype-name
i.e. two columns of enzyme names separated by a space. The first name
of the pair of enzymes is the name that is not preferred and the second
is the preferred (prototype) name.
Notes
The Restriction Enzyme database (REBASE) is a collection of information
about restriction enzymes and related proteins. It contains published
and unpublished references, recognition and cleavage sites,
isoschizomers, commercial availability, methylation sensitivity,
crystal and sequence data. DNA methyltransferases, homing
endonucleases, nicking enzymes, specificity subunits and control
proteins are also included. Most recently, putative DNA
methyltransferases and restriction enzymes, as predicted from analysis
of genomic sequences, are also listed.
The home page of REBASE is: http://rebase.neb.com/
Where the translation is given in the output file, the genetic code and
one or more frames for translation may be specified. The -no[reverse]
option specifies whether the translation (and cut and recognition
sites) are shown for the reverse sense strand.
By default, only one enzyme of any group of isoschizomers (enzymes that
have the same recognition site and cut positions) is reported. This
behaviour can be changed by specifying -nolimit, in which case all
isoschizomers are reported. The default behaviour uses the
representative enzyme of an isoschizomer group (the prototype) which is
specified in the EMBOSS data file embossre.equ. This file is generated
from the REBASE database by running rebaseextract. You may edit this
file to set your own preferred prototype, if you wish.
As well as the display of where enzymes cut in the sequence, remap
displays:
* The list of enzymes that cut the sequence and match the required
criteria.
* The list of enzymes that cut the sequence and fail the MINCUTS
criteria.
* The list of enzymes that cut the sequence and fail the MAXCUTS
criteria.
* The list of enzymes that do not cut the sequence but which match
all the required criteria.
* The number of enzymes that cut the sequence and fail the SITELEN,
BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria.
References
None.
Warnings
remap uses the EMBOSS REBASE restriction enzyme data files stored in
directory data/REBASE/* under the EMBOSS installation directory. These
files must first be set up using the program rebaseextract. Running
rebaseextract may be the job of your system manager.
Diagnostic Error Messages
None.
Exit status
It always exits with status 0.
Known bugs
None.
See also
Program name Description
abiview Display the trace in an ABI sequencer file
backtranambig Back-translate a protein sequence to ambiguous nucleotide
sequence
backtranseq Back-translate a protein sequence to a nucleotide sequence
checktrans Report STOP codons and ORF statistics of a protein
cirdna Draw circular map of DNA constructs
coderet Extract CDS, mRNA and translations from feature tables
iep Calculate the isoelectric point of proteins
lindna Draw linear maps of DNA constructs
pepinfo Plot amino acid properties of a protein sequence in parallel
pepnet Draw a helical net for a protein sequence
pepwheel Draw a helical wheel diagram for a protein sequence
plotorf Plot potential open reading frames in a nucleotide sequence
prettyplot Draw a sequence alignment with pretty formatting
prettyseq Write a nucleotide sequence and its translation to file
recoder Find restriction sites to remove (mutate) with no translation
change
redata Retrieve information from REBASE restriction enzyme database
restover Find restriction enzymes producing a specific overhang
restrict Report restriction enzyme cleavage sites in a nucleotide
sequence
showfeat Display features of a sequence in pretty format
showorf Display a nucleotide sequence and translation in pretty format
showpep Display protein sequences with features in pretty format
showseq Display sequences with features in pretty format
silent Find restriction sites to insert (mutate) with no translation
change
sixpack Display a DNA sequence with 6-frame translation and ORFs
transeq Translate nucleic acid sequences
Author(s)
Gary Williams formerly at:
MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust
Genome Campus, Hinxton, Cambridge, CB10 1SB, UK
Please report all bugs to the EMBOSS bug team
(emboss-bug (c) emboss.open-bio.org) not to the original author.
History
Written Spring 2000
Changed 7 Dec 2000 - GWW - to declare isoschizomers that cut
Target users
This program is intended to be used by everyone and everything, from
naive users to embedded scripts.
Comments
None